Skip to main content
Download PDF

Cytokine priming enhances the antifibrotic effects of human adipose derived mesenchymal stromal cells conditioned medium

Stem Cell Research & Therapy volume 15, Article number: 329 (2024) Cite this article

Abstract

Background

Fibrosis is a pathological scarring process characterized by persistent myofibroblast activation with excessive accumulation of extracellular matrix (ECM). Fibrotic disorders represent an increasing burden of disease-associated morbidity and mortality worldwide for which there are limited therapeutic options. Reversing fibrosis requires the elimination of myofibroblasts, remodeling of the ECM, and regeneration of functional tissue. Multipotent mesenchymal stromal cells (MSC) have antifibrotic properties mediated by secreted factors present in their conditioned medium (MSC-CM). However, there are no standardized in vitro assays to predict the antifibrotic effects of human MSC. As a result, we lack evidence on the effect of cytokine priming on MSC’s antifibrotic effects. We hypothesize that the MSC-CM promotes fibrosis resolution in vitro and that this effect is enhanced following MSC cytokine priming.

Methods

We compared the antifibrotic effects of resting versus interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α) primed MSC-CM in four in vitro assays: prevention of fibroblast activation, myofibroblasts deactivation, ECM degradation and fibrosis resolution in lung explant cultures. Furthermore, we performed transcriptomic analysis of myofibroblasts treated or not with resting or primed MSC-CM and proteomic characterization of resting and primed MSC-CM.

Results

We isolated MSC from adipose tissue of 8 donors, generated MSC-CM and tested each MSC-CM independently. We report that MSC-CM treatment prevented TGF-β induced fibroblast activation to a similar extent as nintedanib but, in contrast to nintedanib, MSC-CM reduced fibrogenic myofibroblasts (i.e. transcriptomic upregulation of apoptosis, senescence, and inflammatory pathways). These effects were larger when primed rather than resting MSC-CM were used. Priming increased the ability of MSC-CM to remodel the ECM, reducing its content of collagen I and fibronectin, and reduced the fibrotic load in TGF-β treated lung explant cultures. Priming increased the following antifibrotic proteins in MSC-CM: DKK1, MMP-1, MMP-3, follistatin and cathepsin S. Inhibition of DKK1 reduced the antifibrotic effects of MSC-CM.

Conclusions

In vitro, MSC-CM promote fibrosis resolution, an effect enhanced following MSC cytokine priming. Specifically, MSC-CM reduces fibrogenic myofibroblasts through apoptosis, senescence, and by enhancing ECM degradation. Future studies will establish the in vivo relevance of MSC priming to fibrosis resolution.

Background

Fibrosis is a pathological tissue repair process characterized by the sustained presence of myofibroblasts and the aberrant accumulation of extracellular matrix (ECM), predominantly fibrillar collagen type I [1, 2]. Repetitive or severe tissue damage and chronic inflammation promote persistent myofibroblasts activation leading to excessive scarring and abnormal tissue repair [3]. Transforming growth factor- beta (TGF-β) is the main profibrotic cytokine. It plays a critical role in activating myofibroblasts with de novo synthesis of alpha- smooth muscle actin (α-SMA) and ECM production. In vitro, TGF-β stimulation of healthy skin fibroblasts is sufficient to induce a profibrotic phenotype [4]. Excessive accumulation of ECM is not only due to collagen overproduction, but to impaired degradation of fibrinous proteins due to an imbalance between proteolytic enzymes (i.e. metalloproteinases- MMP) and their inhibitors (i.e. tissue inhibitors of metalloproteinases- TIMPs) [1]. TGF-β represses MMP-1 [5], induces ACTA2 (Actin alpha 2, smooth muscle) that encodes α-SMA, and promotes TIMP-1 expression and the synthesis of fibronectin and collagen I [6].

Fibrosis can be modulated. The resolution of fibrosis requires the degradation of the ECM; the elimination of fibrogenic myofibroblasts through apoptosis, senescence, dedifferentiation, and/or reprogramming; and the restitution of functional tissue architecture [1]. Currently, there are two approved antifibrotic drugs (i.e. pirfenidone and nintedanib) but their limited benefits highlight the need for alternatives. A potential novel approach is the use of multipotent mesenchymal stromal cells (MSC). MSC are non-hematopoietic plastic-adherent cells with known antifibrotic properties mediated by secreted soluble molecules and small vesicles (i.e. MSC secretome) [7, 8]. The composition of the MSC secretome is modulated by a diversity of factors, mainly proinflammatory cytokines in the local microenvironment [9, 10]. Specifically, MSC priming with interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α), recapitulates the microenvironment of patients with dysregulated immune responses and chronic systemic inflammation [9, 10]. Primed MSC secrete higher levels of immunomodulatory molecules [e.g., PGE2, hepatic growth factor (HGF), IL-10, TNF-α-induced protein 6 (TSG-6)] [10] that enhance the MSC’s immunomodulatory effects [9]. However, the effect of priming on MSC’s fibrosis resolution remains to be characterized. A key barrier, for this is the lack of standardized in vitro antifibrotic assays.

We hypothesize that MSC conditioned medium (MSC-CM) induces fibrosis resolution in vitro, promoting myofibroblasts apoptosis, senescence, and dedifferentiation and that this effect is enhanced post-cytokine priming. We established in vitro assays to assess the antifibrotic effects of MSC-CM, and compared the antifibrotic potential of resting and primed MSC-CM.

Materials and methods

Study subjects

This study was approved by the McGill University Health Center Ethics Review Board (Protocol 10–107 GEN). All participants provided written informed consent. Primary fibroblasts were derived from a single healthy donor. MSC were derived from subcutaneous adipose tissue (AT) from 8 donors, who underwent elective surgery. The demographic characteristics of study participants are summarized in Supplementary Table 1.

Human adipose tissue derived multipotent mesenchymal stromal cells [MSC] isolation and characterization

MSC were isolated from adipose tissue, expanded and characterized (i.e., plastic adherence, surface markers, and tri-lineage differentiation) according to the International Society for Cellular Therapy (ISCT) criteria, as previously described (Supplementary Fig. 1 A-C) [11,12,13]. MSC were cultured in Dulbecco's modified Eagle's medium with 1.0g/L glucose, with L-glutamine & sodium pyruvate (DMEM, Wisent Inc.) supplemented with 10% MSC fetal bovine serum qualified (GIBCO FBS Thermo Fisher Scientific, Waltham, MA) and 1% penicillin–streptomycin. The medium was changed every 3 days. When MSC reached 80% confluency, they were detached with trypsin (Wisent Inc.) and seeded at a density of 5000 cells/cm2. All experiments were performed with passage 3 or 4 MSC.

Resting and cytokine- primed MSC-CM preparation

MSC were primed with IFN-γ and TNF-α as per the ISCT recommendations [9]. Specifically, MSC (8 × 103 cells/cm2) were treated (‘primed’) or not (‘resting’) for 72 h with IFN-γ and TNF-α (R&D Systems, Minneapolis, MN) 10 ng/mL and 15 ng/mL respectively. MSC were then washed with PBS three times and fresh medium without serum was added (phenol red-free DMEM high glucose containing 1% penicillin–streptomycin). At 72 h, MSC-CM were collected, centrifuged (13,000g for 20 min at 4 °C) to remove cell debris, aliquoted, and stored at − 80 °C. Individual MSC-CM were tested within 1 month of generation. Thawed samples were not subsequently frozen. Cytokine-induced MSC activation was confirmed by higher concentrations of kynurenine, a surrogate of indolamine dioxygenase enzyme activity [9], in primed compared to resting MSC-CM. Kynurenine was tested with an absorbance-based assay (Supplementary Fig. 1 D) [14].

Fibroblasts source, culture conditions and TGF-β activation

Primary human fibroblasts were derived from skin biopsies from one healthy donor and isolated according to a standardized protocol [15]. Immortalized normal human diploid foreskin fibroblasts (HCA2) expressing the telomerase catalytic subunit (hTERT) were provided by Dr F. Rodier – University of Montreal. HCA2 hTERT fibroblasts were grown in T75 cell-culture flasks at 37 °C in a 5% CO2 atmosphere in complete fibroblast culture medium [high glucose DMEM supplemented with 10% fetal bovine serum (FBS, Wisent, Inc.) and 1% penicillin–streptomycin]. At 80% confluency, fibroblasts were detached with 0.25% Trypsin–EDTA (37 °C for 5 min) and re-seeded at a density of 5000 cells/cm2.

For activation, fibroblasts 5 × 103/cm2 were seeded in 6-well cell culture plates in complete fibroblast culture media. After 24 h, media was replaced by DMEM with 1% penicillin–streptomycin (serum-free DMEM) and 5ng/mL of active TGF-β was added to each well (R&D Systems, Minneapolis, MN). Myofibroblasts fulfilled three minimal requirements: expression of α-SMA, formation of stress fibers in vitro (contractile capacity) and collagen I synthesis [16, 17]. The myofibroblast phenotype was confirmed after 72 h of TGF-β exposure by determining α-SMA and procollagen I protein levels, visualizing stress fibers and collagen I by immunofluorescence, and evaluating apoptosis resistance by flow cytometry (Supplementary Fig. 2).

Prevention of TGF-β induced fibroblasts activation

To investigate the ability of MSC-CM to prevent fibroblasts activation, fibroblasts (HCA2 hTERT or primary human fibroblasts) were seeded at a density of 5 × 103/cm2 in a 6-well plate in complete fibroblast culture medium and incubated overnight at 37 °C. After fibroblasts’ attachment, complete medium was replaced by serum free DMEM with TGF-β (5ng/ml) and either resting or primed MSC-CM. Fibroblasts and myofibroblasts cultured in serum-free DMEM were used as negative and positive controls, respectively. Following 72 h of culture, proteins were collected and α-SMA and procollagen I were analyzed by Western blot. Collagen I and stress fibers were visualized by immunofluorescence. We performed experiments to ensure precision, linearity and reproducibility of the prevention assay (Supplementary Fig. 3 A, C, F).

Myofibroblasts' deactivation

To evaluate the capacity of MSC-CM to modulate or revert the myofibroblast phenotype, 5 × 103 HCA2 hTERT or primary human fibroblasts/cm2 were seeded in 6 well plates. Following activation, myofibroblasts were washed with PBS, and medium was replaced by serum-free DMEM (control) or by either resting or primed MSC-CM and cultured for 72h. The readouts for these experiments included protein levels of α-SMA and procollagen I and transcriptomic analysis for fibroblasts (F), myofibroblasts (M), myofibroblasts treated with resting (R) or primed (P) MSC-CM. We performed experiments to ensure precision, linearity and reproducibility of the myofibroblast deactivation assay (Supplementary Fig. 3 B, D-E, G).

Western blot

Fibroblasts or myofibroblasts total protein were extracted with RIPA buffer (Thermo Fisher, USA), with Protease Arrest (EMD Millipore Corp, USA) and quantified with a BCA kit (Thermo Fisher, USA). Cell lysates (8- 10 µg) were loaded and separated by SDS-PAGE. Membranes were blocked in 5% milk for 60 min at room temperature. After incubation with primary antibodies: α-SMA (1:500, ab5694, Abcam), procollagen I (1:500, AF6220, R&D systems), β-catenin (1:500, sc-7963, Santa Cruz Biotechnology) and GAPDH (1:100, sc-2357, Santa Cruz Biotechnology) at 4˚C overnight, the membranes were washed three times with PBS Tween and incubated with HRP-conjugated secondary antibodies overnight (1:500, HAF016, R&D systems). Immunoreactive proteins were visualized with Clarity Western ECL Substrate (BioRad) using an Omega Lum™ C Imaging System (Aplegen®, San Francisco, CA). Results were analysed with the ImageJ software and normalized to GAPDH.

Modulation of extracellular collagen I and fibronectin

To study the effect of MSC-CM on ECM deposition, 75 × 103 fibroblasts/ well were seeded in an 8-chamber slide. After 24 h, fibroblasts were activated with TGF-β as described above. After 48 h, medium was replaced by 500 µl of resting or primed MSC-CM or serum-free DMEM (control). All experiments were run in duplicate. Following five days of incubation, cells were washed with PBS and fixed with 4% paraformaldehyde. Collagen I and fibronectin were evaluated by immunofluorescence [18].

Immunofluorescence analysis

To visualize stress fibers and procollagen I, fibroblasts or myofibroblasts were fixed with 4% paraformaldehyde (PFA) for 12 min, and permeabilized with 0.1% Triton-X in PBS for 10 min. To prevent non-specific binding, samples were treated for 40 min with blocking solution (22.52 mg/ml glycine in PBST -0.1% Tween 20 in PBS- supplemented with 5% FBS) and incubated overnight at 4 °C with sheep anti-human Procollagen I antibody (1:750, AF6220, R&D systems), and Phalloidin-iFluor 647 reagent (1:1000, Abcam) which binds fibrillar actin highlighting stress fibers. Secondary antibodies were a CY3-conjugated goat anti-rabbit immunoglobulin G (1:250) and Alexa fluor 488 donkey anti-sheep immunoglobulin G (1:250, Abcam). Nucleus were stained with 0.3 µM 4′,6-Diamidino-2-Phenylindole (DAPI). Procollagen I and stress fibers were visualized using a Zeiss LSM780 Laser Scanning Confocal Microscope.

To evaluate extracellular collagen I and fibronectin, myofibroblasts were fixed with 4% PFA at room temperature for 15 min. Cells were not permeabilized as to visualize only the secreted extracellular fibers. After washing with PBS, 150 µl of blocking buffer (1:10 of normal donkey serum/PBS, Jackson Immuno Research labs, 005-555121) was added to each well and incubated for 30 min at 25 °C. Then, samples were incubated for 90 min with primary antibodies for collagen I (1:1000, AF6220, R&D systems) and fibronectin (1:1000, IST-9 ab6328, Abcam). The specificity of these antibodies was previously demonstrated [19, 20]. Negative controls consisted in omission of the primary antibodies as per manufacturer’s recommendations (Fluorescent ICC Staining of Cells on Coverslips). Slides were washed three times with PBS and incubated for 90 min with immunofluorescent antibodies (1:750 Anti-mouse IgG Alexa Fluor® 555 #4409, Cell Signaling Technology and 1:750 Donkey Anti-Sheep IgG Alexa Fluor® 488, ab150177, Abcam). Nucleus were identified with 0.3 μM of DAPI. Five fields (40X) of each sample were selected randomly using a Zeiss LSM780 Laser Scanning Confocal Microscope and recorded using identical microscope settings. Images were analyzed with ImageJ software. Quantification was done following a standardized protocol measuring the Total Specific Intensity of fibronectin and collagen I fibers normalized to the number of nuclei [21]. Myofibroblast viability was assessed by flow cytometry. Myofibroblasts and supernatant were collected and centrifuged at 1000 × g, for 10 min at 4 °C. The cell pellet was resuspended in Annexin V Binding Buffer 1X (BD Biosciences) with PE-conjugated Annexin V (AB_286907, BD Biosciences) and DRAQ7 (far-red fluorescent DNA dye, Abcam UK), and incubated for 15 min at 25 °C in the dark. Cell viability (i.e. defined as annexin V negative and DRAQ7 negative) was assessed by flow cytometry using BD LSRFortessa cell analyzer, and the data was analyzed with FlowJo software 10.8.1.

Explant cultures of murine lungs

C57BL/6 mice purchased from Jackson Laboratories were housed and bred in a conventional animal facility at the Research Institute of the McGill University Health Centre (RI-MUHC). Animals were treated in accordance with the guidelines of the Canadian Council of Animal Care (CCAC) and protocols were approved by the Animal Care Committee of McGill University. Additionally, this work has been reported in line with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines 2.0. Healthy 8–10-week-old C57BL/6 male mice were euthanized by pentobarbital overdose. The aorta was cut, and the right ventricle was perfused with 10mL of ice-cold PBS. Once removed, lungs were separated from the trachea and large cartilages, and 3mm2 sections were obtained with a punch biopsy. A total of twenty punches were obtained from both lungs, placed in four wells of a six-well plate (5 punches/well – experimental unit), and cultured at 37 °C in a 5% CO2 atmosphere in complete fibroblast culture medium.

To test the MSC-CM effect on fibrosis prevention (i.e. prevention of TGF-β explant activation assay), at 24 h the lung culture medium was replaced by resting or primed MSC-CM and 20ng/mL of TGF-β. DMEM alone or DMEM with 20ng/mL of TGF-β served as positive and negative controls, respectively. After 72 h, sections were snap frozen for RT-qPCR analysis or fixed for histology. To investigate the MSC-CM effect on resolution of fibrosis (i.e. myofibroblast deactivation explant assays), at 24 h the lung culture medium was replaced by DMEM with 20 ng/mL of active TGF-β. DMEM alone or DMEM with 20 ng/mL of TGF-β served as positive and negative controls, respectively. Three days later, the medium was changed for MSC-CM or DMEM. After 72 h, lungs were snap frozen in liquid nitrogen and stored at − 80 °C for RT-qPCR analysis or fixed for histology. A total of 4 independent experiments were conducted for each of the assays (i.e. fibrosis prevention and resolution). The number of experiments were determined a priori based on preliminary histological results (collagen content) and all data was included in the analysis.

Lung explants histology

Mice lung explants were fixed in 10% buffered formalin for 24 h, embedded in paraffin, and cut into 4 \(\upmu\)m-thick sections. Slides were stained with Picrosirius Red (PSR), visualized under a polarized light microscope and the amount of collagen in each section was quantified with the ImageJ software. The evaluator was not aware of the intervention allocation per slide at the time of analysis (e.g. blind assessment).

Real time (RT)-qPCR

RNA isolation from lung punch biopsies was performed with the QIAGEN miRNeasy Micro Kit. cDNA and RT-qPCR were generated using the Qiagen SYBR green RT-PCR kit, as per the manufacturer’s instructions. The primer sequences used to determine mice collagen type I alpha 1 were: Col1A1; forward: ACCTTCCTGCGCCTAATGTC; reverse: AGTTCC GGTGTGACTCGTG. The relative expression of Col1A1 was calculated using the ΔΔCt method. Data were normalized to the housekeeping gene Gapdh.

RNA-seq and differential gene expression analysis

Fibroblasts (F), myofibroblasts (M), and myofibroblasts treated with resting (R) or primed (P) MSC-CM were collected and preserved in RNAprotect Cell Reagent (Qiagen, Germany) and stored at − 80 °C until RNA isolation. RNA was isolated with the RNeasy Micro Kit (Qiagen, Germany) according to the manufacturer’s protocol. Bulk RNA-seq was performed as previously described [22]. Briefly, total RNA was depleted of rRNA, and cDNA libraries were prepared for paired-end 100 bp read sequencing on Illumina NovaSeq 6000. Low-quality bases (Phred < 33) and adaptor sequences were removed with the Trimmomatic v.0.36 tool [23] using the following arguments: ILLUMINACLIP:TruSeq3-PE.fa:2:30:10:2:TRUE HEADCROP:4 LEADING:5 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36. Trimmed reads were aligned to the human GRCh38 (hg38) reference genome using HISAT2 v2.2.1 [24], and raw gene expression counts were quantified by counting the number of strand-specific reads aligning to gene exon features using featureCounts (Subread package v2.0.5 [25]). Raw read count libraries were filtered to remove residual rRNA reads, and to retain genes expressed above 5 counts per million reads (CPM) in at least 3 samples, for a total of 11,163 expressed genes. Filtered count libraries were normalized with the TMM method and differential gene expression was assessed pairwise between sample groups using Fisher’s exact test in edgeR v3.42.4 R package [26]. Differentially expressed genes (DEG) met a cut-off of ± twofold change between groups and a threshold of q < 0.001 (Benjamini-Hochberg (BH)-adjusted p-value).

Gene set enrichment, leading edge, and gene module analyses

Gene set enrichment analysis (GSEA) [27] was performed across all 11,163 expressed genes to detect the enrichment of gene sets publicly listed in the MSigDB C2 Curated Gene Sets (C2.all.v2023.2) collection, specifically n = 4,270 gene sets meeting a gene set size filter of between 15 to 500 genes. Enriched gene sets that met a BH-adjusted p-value cut-off of at least q < 0.05 were considered significantly enriched in each pairwise group comparison. Leading edge analyses were performed as previously described [28] to cluster enriched gene sets against leading edge genes to group similar or redundant signatures together. Only leading-edge genes that were represented in at least 5% of all enriched gene sets (q < 0.05) were included for hierarchical clustering. Across each pairwise group comparison, leading edge genes underlying hierarchical clusters of interest were compiled into 5 gene modules (TGF-β, Apoptosis, Inflammation, Fibrosis, and Extracellular Matrix); a sixth gene module (Senescence) was compiled from previously published gene lists [29]. Gene module scores were calculated for each module using a method adapted from the AddModuleScore function in the Seurat v4 R package [30] and from the Github repository “AddModuleScore” (https://github.com/WalterMuskovic/AddModuleScore).

Proteomic analysis of MSC-CM

MSC-CM were centrifuged for 45 min in 3 kDa filters (Ultracel YM-3, Microcon). The proteinaceous fraction was retained and quantified with Bradford Assay (Bio-Rad Protein Assay Dye Reagent Concentrate). Proteomic analysis of resting and primed MSC-CM (50 µL =  ~ 9ug protein/µL) was performed by the Proteomics Platform of The Research Institute of the McGill University Health Centre (RI-MUHC). Liquid chromatography tandem mass spectrometry (LC–MS/MS; Thermo Scientific Ultimate 3000 HPLC and Orbitrap Fusion MS) was conducted. Samples were processed as previously described [11]. Following data acquisition, the raw data was searched in the Mascot search engine (Matrix Science, London, UK; version 2.6.2) against Homo sapiens protein sequences (SwissProt 2022_03 and 2022_04; 20,646 and 20,649 entries respectively). Assuming the digestion enzyme trypsin, Mascot was searched with a fragmentation mass tolerance of 0.100 Da and a parent ion tolerance of 5.0 PPM. Carboxymethyl of cysteine was specified in Mascot as a fixed modification. Deamidation of asparagine and glutamine as well as oxidation of methionine were specified in Mascot as variable modifications. The mass spectrometry proteomics dataset is available in the ProteomeXchange Consortium via the PRIDE [31] partner repository with the dataset identifier PXD051586.

Bioinformatic data processing and analysis of mass spectrometry data

The database search results were loaded onto Scaffold 5 (Scaffold version_5.2.0, Proteome Software Inc., Portland, OR) for protein identification, validation, data filtering, and statistical testing. Protein identifications with greater than 99.0% probability assigned by the Protein Prophet algorithm and containing ≥ 2 identified peptides were analyzed. Peptide identifications with greater than 95.0% probability by the Scaffold Local FDR algorithm were analyzed. Decoy peptide false discovery rate (FDR) was determined to be 0.00% and the decoy protein FDR was 0.3%. Statistical significance was considered if the T-test p-value was < 0.05. The total spectra values were normalized. The normalization coefficient used to adjust the values for a specific column was given by the ratio of the average number of unique spectra in all the columns divided by the number of unique spectra in a column. The R programming language (RStudio 2022.07.1 +) was used to conduct principal component analysis (PCA) the prcomp() function was used with scale = TRUE specified as an argument. Statistically significant proteins with a fold change greater than or equal to 2 (with resting MSC-CM as the reference category) were considered for further functional annotation.

Multiplex analysis of metalloproteases (MMPs) and tissue inhibitors of metalloproteases (TIMPs)

Luminex xMAP multiplexing analysis (Luminex™ 200 system, Luminex, Austin, TX, USA by Eve Technologies Corp. Calgary, Alberta) was used for quantification of human cytokines, chemokines and growth factors. Thirteen markers were simultaneously measured in samples from resting and primed MSC-CM with the Eve Technologies' Human MMP/TIMP 13-Plex Discovery Assay®. Assay sensitivities for components of the 13-plex range from 0.28 to 253 pg/mL.

Statistical analysis

Statistical analyses were performed using GraphPad Prism software (Graph-Pad, San Diego, CA). Results from experiments evaluating the effect of CM obtained from different MSC donors are exhibited as individual points in graphs and means ± standard deviations are shown. Non-parametric analyses were used for all comparisons. Multiple comparisons were performed with one-way ANOVA with Tukey’s test. A p-value of < 0.05 was considered statistically significant. In each figure, asterisks indicate the statistical significance. The statistical analysis of the proteomic and RNA-seq data are addressed in their respective sections.

Results

MSC-CM prevent fibroblast activation, reduce myofibroblast α-SMA and procollagen I production and stimulate ECM degradation

We tested the antifibrotic effects of resting and primed CM from 8 different MSC donors in four in vitro assays. First, we evaluated the capacity of either resting or primed MSC-CM to inhibit fibroblast activation in the presence of TGF-β (i.e. prevention assay). Resting and primed CM reduced the intracellular procollagen I and α-SMA stress fibers—phalloidin Fig. 1A (procollagen I, M vs. R vs. P, n = 8 mean ± SD: 1.54 ± 0.22 vs.0.91 ± 0.21 vs. 0.40 ± 0.36. α-SMA, M vs. R vs. P, n = 8 mean ± SD: 1.76 ± 0.32 vs.0.23 ± 0.16 vs. 0.20 ± 0.12- Fig. 1B). The effect on procollagen I was maximal when fibroblasts were treated with primed MSC-CM (Fig. 1B).

Fig. 1
figure 1

Cytokine primed MSC-CM reduce fibroblast activation and promote myofibroblast deactivation in vitro. Fibroblasts were simultaneously treated with TGF-β and either resting (R) or cytokine primed (P) MSC-CM (i.e. prevention of TGF-β induced fibroblast activation assay). A Representative images showing reduction in intracellular collagen I (green) and stress fibers- phalloidin (red) in myofibroblasts treated with primed MSC-CM (scale: 100µm) and B Quantification of procollagen I and α-SMA by Western blot. C After 72 h of TGF-β activation, myofibroblasts were treated with either resting or primed MSC-CM (i.e. myofibroblast deactivation assay). Graphs depict the results of 8 independent experiments with means ± SD, ns = non-significant differences, *p < 0.05, **p < 0.01, ***p < 0.001. F: fibroblasts, M: myofibroblasts, R: myofibroblasts treated with resting MSC-CM, P: myofibroblasts treated with primed MSC-CM

Full size image

Next, we treated myofibroblasts with either resting or primed MSC-CM to assess ‘myofibroblast deactivation’. Independent of priming state, CM treatment resulted in a reduction of procollagen I and α-SMA. The effect on procollagen was more pronounced following treatment with primed MSC-CM (procollagen I: M vs. R vs. P, n = 8 mean ± SD: 1.88 ± 0.52 vs. 0.87 ± 0.27 vs. 0.31 ± 0.33. α-SMA, M vs. R vs. P, n = 8 mean ± SD: 2.18 ± 0.74 vs. 0.61 ± 0.47 vs. 0.53 ± 0.39- Fig. 1C). We also compared the relative antifibrotic effect of MSC-CM to that of high doses of nintedanib, a tyrosine kinase inhibitor that prevents TGF-β-induced fibroblast to myofibroblast activation of primary human idiopathic pulmonary fibrosis lung fibroblasts [32]. In the prevention of TGF-β fibroblast activation, nintedanib (1 μM) and primed CM had similar effects (Supplementary Fig. 4A). In the myofibroblast deactivation assay, in contrast to primed CM, nintedanib did not reduce α-SMA and procollagen I protein levels (Supplementary Fig. 4B).

As a third approach, we tested the MSC-CM capacity to modulate fibronectin and collagen I extracellular fibers and compared the effect of resting versus primed MSC-CM on ECM remodeling. Following 5 days of MSC-CM treatment, myofibroblasts, fibronectin and collagen I fibers appeared less mature and thinner compared to fibers secreted by myofibroblasts not treated with primed MSC-CM (Fig. 2A). The quantification of fibers (i.e., Total Specific Intensity of the ECM fibers normalized to the number of myofibroblasts) confirmed that primed but not resting MSC-CM treatment reduced the amount of both collagen I (Total specific intensity/cell: M vs. R vs. P, n = 7 mean ± SD: 79,257 ± 41,838 vs 48,312 ± 22,802 vs 32,288 ± 17,567) and fibronectin (Total specific intensity/cell: M vs. R vs. P, n = 7 mean ± SD: 61,122 ± 12,564 vs 41,072 ± 20,872 vs 30,956 ± 18,890) (Fig. 2B). Of relevance, this effect was not explained by reduced myofibroblast viability (Fig. 2C) and was independent of MSC donor age (Supplementary Fig. 5).

Fig. 2
figure 2

Primed MSC-CM treatment changes the structure of extracellular collagen I and fibronectin. A Representative images showing collagen I (green) and fibronectin (red) secreted by myofibroblasts (scale: 100µm). After 5 days-treatment with primed MSC-CM. B Graphs summarizing the results from 7 independent experiments each with different MSC-CM. Each dot represents the average of 5 images. C Myofibroblast survival (annexin Vneg/DRAQ7.neg) was evaluated by flow cytometry (n = 6). ns = non-significant differences, *p < 0.05, **p < 0.01, ***p < 0.001

Full size image

Finally, we evaluated the antifibrotic effects of MSC-CM and their modulation by MSC priming in lung explant cultures. Both, in the prevention of TGF-β explant activation assay and in the myofibroblast deactivation explant assay, the addition of MSC-CM reduced collagen I transcripts and histological evidence of fibrosis. These effects were enhanced when CM from primed MSC was used (prevention of TGF-β explant activation assay: Col1A1: M vs. R vs. P, n = 4 mean ± SD: 2.86 ± 0.9 vs. 1.98 ± 0.43 vs. 1.35 ± 0.52. PSR, M vs. R vs. P, n = 8 mean ± SD: 27.3 ± 2.4 vs. 24.8 ± 3.9 vs. 19.15 ± 5.2. Myofibroblast deactivation explant assay: Col1A1: M vs. R vs. P, n = 4 mean ± SD: 2.75 ± 0.25 vs. 2 ± 0.62 vs. 1.46 ± 0.56. PSR, M vs. R vs. P, n = 8 mean ± SD: 35.2 ± 1.2 vs. 18 ± 2 vs. 15.8 ± 1.5). Altogether, these four assays confirm the in vitro antifibrotic effects of MSC-CM which are enhanced following MSC cytokine priming (Fig. 3).

Fig. 3
figure 3

Primed MSC-CM treatment reduces fibrotic content in ex vivo lung explants. A–C Prevention of TGF-β explant activation assay: A Schematic workflow of the assay. B Representative images of negative controls (DMEM), positive controls (TGF-β + DMEM), and explants treated with MSC-CM resting (TGF-β + MSC-CM R) or primed MSC-CM (TGF-β + MSC-CM P). C Picrosirius red quantification (PSR) and collagen I gene expression. D-F Myofibroblast deactivation explant assay: D Schematic workflow of the assay. E Representative images of experimental conditions. F PSR quantification and collagen I gene expression. Graphs depict the results of 4 independent experiments with means ± SD. ns = non-significant differences, *p < 0.05, **p < 0.01, ***p < 0.001. F: fibroblasts, M: myofibroblasts, R: myofibroblasts treated with resting MSC-CM, P: myofibroblasts treated with primed MSC-CM

Full size image

Primed MSC-CM treatment changes the fate of fibrogenic myofibroblasts

To evaluate the in vitro effects of TGF-β-dependent fibroblast activation and subsequent MSC-CM treatment on the global transcriptome, bulk RNA-seq was performed on fibroblasts (F), myofibroblasts (M), and myofibroblasts treated with resting (R) or primed (P) MSC-CM. First, a principal component analysis (PCA) revealed that 76.1% of the variance in gene expression across all samples was captured in the first principal component, an axis that separated fibroblasts from all myofibroblast samples and corresponded to the fibrogenic effect of TGF-β treatment (Supplementary Fig. 6A). Compared to fibroblasts, myofibroblasts upregulated 714 and downregulated 904 differentially expressed genes (DEG) (Supplementary Fig. 6B, Supplementary Table 2), which contributed to the enrichment of several gene signatures related to fibrosis, tRNA amino acetylation, and TGF-β/WNT signaling cascades (Supplementary Fig. 7A-B, Supplementary Table 3). Specifically, high TGF-β module scores, aggregated from TGF-β pathway leading edge genes, were only detected in myofibroblasts, resting and primed MSC-CM-treated myofibroblasts (Supplementary Fig. 6C, Supplementary Table 4). These elevated TGF-β module scores persisted following MSC-CM treatments. Together with the nearby clustering of all three myofibroblast groups in the PCA, these data suggest that MSC-CM treatment does not fundamentally revert myofibroblasts back to TGF-β-naïve fibroblasts at the transcriptional level.

Next, we focused on the contribution of resting or cytokine primed MSC-CM treatment on the transcriptional programs of myofibroblasts to assess any effects on fibrosis dampening or resolution. In a second PCA performed only on myofibroblasts, the transcriptional landscape of primed MSC-CM-treated myofibroblasts separated further away from either resting MSC-CM-treated or non-treated myofibroblasts (Fig. 4A). This change in the transcriptional response was driven by 96 DEG versus 42 DEG occurring in primed or resting MSC-CM-treated myofibroblasts respectively, each compared to myofibroblasts (Fig. 4B). Primed MSC-CM-treated myofibroblasts were also the only group to exhibit up- and downregulated DEG clusters compared to both myofibroblasts and to baseline fibroblasts (Fig. 4C). Using gene set enrichment analysis (GSEA) to evaluate the over- or underrepresentation of gene sets among all DEG and non-DEG expressed in our dataset, resting MSC-CM-treated myofibroblasts displayed 363 significantly (q < 0.05) enriched gene sets including proliferation and metabolism signatures, and 205 underrepresented primarily fibrotic and inflammatory gene sets compared to myofibroblasts (Fig. 4D left, Supplementary Fig. 7C-D). On the other hand, primed MSC-CM-treated myofibroblasts were enriched for 463 gene sets involved in apoptosis, proliferation and inflammation signatures, and negatively enriched for fibrosis and extracellular matrix signatures (Fig. 4D right, Supplementary Fig. 7E-F). Focusing on leading edge genes, primed MSC-CM-treated myofibroblasts were further distinguished by a singular increase in module scores related to senescence (including DPP4 and other reported senescence genes [29]), inflammation (via NF-κB, IL6, and various chemokine genes), and apoptosis (via TP53, MDM2, NF-κB, and caspase signaling), compared to all other groups (Fig. 4E; Supplementary Fig. 8B-D). Importantly, myofibroblasts treated with resting or primed MSC-CM also experienced a stepwise decrease in fibrosis and extracellular matrix module scores (encompassing various matrix metalloprotease-, collagen-, integrin-, CCN- and laminin-family matricellular genes), with primed MSC-CM having the strongest antifibrotic effect on the myofibroblast transcriptome (Fig. 4F; Supplementary Fig. 8E-F). Overall, these findings highlight the antifibrotic effects of MSC-CM on myofibroblasts in vitro where fibrogenic transcriptional programs are reduced following resting MSC-CM treatment, and further reduced by primed MSC-CM treatment.

Fig. 4
figure 4

Transcriptional landscape of human fibroblasts treated TGF-β with and without resting or primed MSC-CM. Bulk RNA-seq was performed on fibroblasts (F), TGF-β-treated fibroblasts (myofibroblasts, M), and on myofibroblasts treated with resting MSC-CM (R) or with IFN-γ/TNF-α-primed MSC-CM (P) (n = 5 per group). A Principal component analysis (PCA) in M, R and P samples across 11,163 expressed genes at > 5 counts per million reads (CPM) in at least 3 samples. B Volcano plot of differentially expressed genes (DEG) in R versus M groups (left; 42 significant DEGs), and P versus M groups (right; 97 significant DEG), with a threshold of ± twofold change and q < 0.05 (Benjamini–Hochberg adjusted). C Heatmap of 214 total DEG calculated between groups M, R and P representing LOG2CPM gene expression in each sample expressed relative to group F. Hierarchical clustering of DEG was performed using Pearson correlation and Manhattan distance. D Normalized enrichment scores of canonical signaling pathway gene expression signatures using Gene Set Enrichment Analysis (GSEA). Positively (red) and negatively (blue) enriched gene sets met a cut-off of q < 0.05 (Benjamini–Hochberg adjusted). E, F Gene module scores calculated across all groups for E senescence, apoptosis, and inflammation gene signatures, and F fibrosis and extracellular matrix gene signatures. Data represent mean ± SD. Statistical test: One-way ANOVA with Tukey’s multiple correction test, * p < 0.05, ** p < 0.01, **** p < 0.0001

Full size image

Resting and cytokine- primed MSC-CM differ in their antifibrotic protein content

To further characterize the mechanisms underlying the increased antifibrotic effects of primed MSC-CM, we tested whether those predominantly derived from the protein fraction or other components of the MSC secretome. Following the fractionation of resting and primed MSC-CM (i.e. proteins vs non-protein fraction) we repeated the prevention assay with each fraction. Independently of MSC priming, the protein fraction of the CM recapitulated up to 68% of the effect at reducing procollagen I and 86% of α-SMA (Supplementary Fig. 9). We next characterized the composition of the protein fraction of resting and primed MSC-CM by mass spectrometry analysis (resting vs primed MSC-CM from 4 different MSC donors). PCA illustrated a clear partition between resting and primed MSC-CM in which the first two principal components accounted for 61.9% of variability observed in the data (Fig. 5A). Among the 453 total proteins identified, 62 were different (p < 0.05) between resting and primed MSC-CM. Of those, 43 also exhibited a fold change (FC) greater than or equal to 2, using resting MSC-CM as reference category (Fig. 5B). Those 43 proteins were included in further analyses. Differences in protein abundance, represented by log2 normalized total spectra values, were observed between resting and primed MSC-CM (Fig. 5C). Primed MSC-CM contained 27 unique proteins not detected in resting MSC-CM. Among the 43 proteins with FC ≥ 2, six key candidate antifibrotic soluble factors were selected based on functional annotation data (Supplementary Fig. 10). MMP-1, MMP-3, and follistatin (FST) were more abundant in primed MSC-CM whereas cathepsin S (CTSS), Dickkopf-1 (DKK1), and endothelial protein C receptor (PROCR) were only present in primed MSC-CM (Fig. 5D). To confirm these results, we measured MMPs and their inhibitors (TIMPs) by multiplex immunoassays. MMP-1 and MMP-3 were increased in primed MSC-CM and there were no changes in the concentration of TIMP-1 or -2 (Fig. 5E-F). In addition, we measured β-catenin protein levels which were decreased in myofibroblasts treated with primed MSC-CM compared to myofibroblasts. This effect was blocked with a DKK1 inhibitory antibody (DKK1 Ab) (M vs primed MSC-CM vs primed MSC-CM + DKK1 Ab, β-catenin: 1.21 ± 0.33 vs 0.76 ± 0.16 vs 1.15 ± 0.42); supporting the role of DKK1 antifibrotic effects in primed MSC-CM (Fig. 6 A-C). Altogether, these results prove that cytokine priming enhances the content of antifibrotic proteins in the MSC-CM. In turn, this mediates the increased in vitro antifibrotic effects of primed MSC-CM treatment.

Fig. 5
figure 5

Priming changes the content of antifibrotic proteins in the MSC-CM. LC/MS–MS analysis of resting and primed MSC-CM. A Principal component analysis (PCA), (n = 4) B Venn diagrams indicating the total amount of identified proteins in MSC-CM (black = resting MSC-CM, white = primed MSC-CM) and C Heatmap of 43 proteins with a threshold of ± twofold change and p < 0.05 in resting and primed MSC-CM (red = present-high, blue = absent). Underlined are the proteins with known antifibrotic effects. D Antifibrotic proteins differentially present in primed MSC-CM. Multiplex analysis of E metalloproteases (MMP): MMP-1 and MMP-3 and F. tissue inhibitors of metalloproteases (TIMP) in resting and primed MSC-CM (n = 7). ns = non-significant differences, *p < 0.05. CTSS: Cathepsin S, FST: Follistatin, DKK1: Dickkopf-1, PROCR: Endothelial protein C receptor

Full size image
Fig. 6
figure 6

DKK1 in primed MSC-CM inhibits the WNT pathway reducing β-catenin transcription. A Schematic representation of the WNT pathway and the inhibitory effect of DDK1 on β-catenin intracellular levels. B Western blot representative images and C summary graph of β-catenin abundance normalized by GAPDH intensity, (n = 6) ns = non-significant differences, *p < 0.05

Full size image

Discussion

Fibrosis is a multi-step process fostered by diverse, complex, and redundant mechanisms. An uncontrolled fibrotic response is implicated in multiple prevalent conditions, particularly in most chronic inflammatory diseases, and is considered a final pathological process of maladaptive repair [33]. MSC exert antifibrotic effects through modulating the activity of immune cells, inhibiting the expression of profibrotic genes, reducing collagen deposition and promoting tissue repair [34, 35]. For these reasons, MSC are promising therapeutics for fibrotic conditions. Properly standardized in vitro antifibrotic assays and clear understanding of how to enhance MSC fibrotic resolution responses are key for the successful translation of MSC into the clinic. To evaluate complex processes, such as fibrosis, the use of multiple readouts is recommended [36]. In this study we assessed the effect of MSC-CM on ECM degradation, altering myofibroblasts’ fate, and inhibiting TGF-β induced fibroblast activation. We showed in functional in vitro assays, and confirmed with transcriptomic and proteomic data that priming enhances consistently the antifibrotic effects of MSC-CM promoting ECM remodeling/degradation, ‘fibroblast-resistance’ to the effect of TGF-β, and myofibroblast apoptosis, senescence, inflammation and de-activation. The effect of primed MSC-CM is comparable to that of high doses of nintedanib in the prevention of TGF-β fibroblast activation assay. Only MSC-CM, but not nintedanib, promote myofibroblasts deactivation. Primed MSC-CM-treated myofibroblasts are enriched for genes involved in apoptosis and senescence signatures, two key mechanisms implicated in fibrosis resolution [1]. In addition, they are negatively enriched for fibrosis and ECM module scores, which further emphasize the antifibrotic capability of MSC-CM. Moreover, we demonstrated that the enhanced effects of primed MSC-CM over resting MSC-CM are mediated by increases in the content of key antifibrotic proteins in primed MSC-CM, specifically MMP-1, MMP-3 and DKK1.

MMPs are classified according to their sub-cellular distribution and their affinity for components of the ECM [37]. MMP-1 is a collagenase capable of degrading triple-helical fibrillar collagen [37, 38]. MMP-3 is one of the stromelysins, small molecules that degrade segments of ECM, like fibronectin [37]. The levels of MMP-1 and MMP-3 were more abundant in primed MSC-CM compared to resting MSC-CM, aligning with the proteomic results. Importantly, given that MMPs are inhibited in 1:1 stoichiometric form by TIMPs, we did not find discernible changes in the concentration of TIMPs following MSC priming [39]. These findings are consistent with previous studies that demonstrated an upregulation of MMPs at the transcriptomic level in MSC in response to cytokine priming [40].

DKK1 was another antifibrotic protein increased in primed MSC-CM. DKK1 serves as an antagonist of the Wnt/β-catenin signalling cascade. It binds the LRP6 co-receptor and promotes the hyperphosphorylation of β-catenin, inducing its degradation. Antifibrotic effects of MSC-CM have been attributed to DKK-1 in animal models [41,42,43]. In patients with systemic sclerosis, the sustained activation of the Wnt/β-catenin pathway inhibits adipocyte differentiation and triggers fibrotic skin lesions [44]. Notably, DKK1 levels are low in systemic sclerosis patients and DKK1 is downregulated by TGF-β, which is required for TGF-β mediated fibrosis [45]. Our results show that primed MSC-CM exerts an inhibitory effect on the Wnt/β-catenin pathway. We confirmed the direct link between this effect and DKK1, as the inhibition of DKK1 blocked the modulation of β-catenin levels. Other proteins identified in the primed MSC-CM with known antifibrotic effects included follistatin which inhibits TGF-β canonical pathway and collagen I expression [46, 47]; Cathepsin S that is involved in TGF-β activation [48, 49], and endothelial protein C receptor which inhibits endothelial to mesenchymal transition [50].

Two fascinating effects of primed MSC-CM that this work put in evidence include its capacity to remodel ECM and its effect on reducing fibrogenic myofibroblasts. Eliminating excessive ECM is necessary to reverting fibrosis [51]. Fibronectin and collagen I are two key ECM proteins. Fibronectin is a “master organizer” in ECM assembly [52], while collagen I is the most abundant protein accumulated in fibrotic diseases [53]. The relevance of collagen degradation in fibrosis resolution is evidenced by the impaired collagenolytic activity of tissues in fibrotic diseases [1, 54]. In contrast to MSC-CM, the current approved antifibrotics do not remodel ECM. Nintedanib, in vitro only at supratherapeutic doses reduces formation of collagen I [6]. Pirfenidone prevents the synthesis of collagen I but does not change α-SMA in myofibroblasts [55]. Given that activated myofibroblasts are the primary source of the fibrotic ECM, the change in their profibrotic phenotype is a prerequisite for fibrosis resolution. Here, we demonstrated a superior antifibrotic effect in vitro of primed MSC-CM on myofibroblasts, differentially decreasing the protein levels of collagen I and changing the myofibroblast phenotype. At a transcriptomic level, although the myofibroblast profile was not reverted to a non-stimulated fibroblast state, primed MSC-CM downregulated fibrosis and extracellular matrix signatures and promoted apoptosis and senescence.

Our work has some limitations. First, the in vitro assays we established captured specific parts of the fibrotic process and evaluate the response of myofibroblasts to MSC-CM. However, they do not recapitulate the complex pathophysiology of fibrosis. Nevertheless, the use of multiparametric approaches combining early (e.g., α-SMA) and late (e.g., mature collagen and fibronectin) hallmarks of fibrosis, counteract the reductionist approach of in vitro assays. Second, the assays in this manuscript were established based on their biological relevance for the study of fibrosis. We defined and optimized test parameters to ensure precision, linearity and consistency of the assays which is required during the initial phase of assay standardization. However, the primary goal of our work was not to standardize antifibrotic assays which would have required ensuring inter-laboratory reproducibility, validation and acceptance from regulatory entities [56]. Third, given that MSC functions are mainly mediated through paracrine mechanisms, we tested the antifibrotic effects of the MSC-secretome. Future studies should evaluate the contribution of cell–cell interaction to the antifibrotic effects of MSC.

Despite these limitations, robust in vitro antifibrotic assays were established to assess the effects of MSC-CM on TGF-β pathway activation; myofibroblasts α-SMA and procollagen I protein levels, and mature ECM. Fibrotic diseases represent an increasing cause of morbidity, mortality, and financial burden worldwide [2]. The burden of fibrosis is not only explained by the large number of affected individuals, but also by the incomplete understanding of the pathogenesis of the fibrotic process, the marked etiological and clinical heterogeneity, the absence of validated biomarkers, and, most importantly, the lack of a ‘cure for fibrosis’ [57]. Cytokine priming modifies the composition of the MSC secretome [11], enhancing MSC immunopotency [58]. Here, we provide direct evidence of an antifibrotic in vitro effect of MSC-CM which, like the MSC-immunoregulatory effects, is enhanced following priming. We posit that the in vitro assays we used to test different components of the fibrotic process could be valuable at predicting fibrosis resolution in vivo. As such, they may help identify most efficiently cellular products with higher antifibrotic effects to be used clinically.

Conclusion

Two key processes are required to reverse fibrosis: elimination of pro-fibrotic myofibroblasts, and ECM degradation [51, 59]. We designed assays that evaluated key events in the fibrotic process combining early (e.g., α-SMA) and late (e.g., mature collagen) readouts. Our results indicate that MSC-CM, in particular following MSC priming, promote fibrosis resolution by preventing fibroblasts activation, decreasing profibrotic myofibroblasts and enhancing ECM degradation.

Availability of data and materials

The mass spectrometry proteomics dataset is available in the ProteomeXchange Consortium via the PRIDE [30] partner repository with the dataset identifier PXD051586. The datasets generated from bulk RNA-seq reported in the current study are available in the NCBI Gene Expression Omnibus repository, accession: GSE266052.

Abbreviations

Ab:

Antibody

ACTA2:

Actin alpha 2, smooth muscle

CTSS:

Cathepsin S

DAPI:

4′,6-Diamidino-2-Phenylindole

DKK1:

Dickkopf-1

ECM:

Extracellular matrix

F:

Fibroblasts

GAPDH:

Glyceraldehyde-3-phosphate dehydrogenase

HCA2:

Immortalized normal human diploid fibroblasts

HGF:

Hepatic growth factor

hMSC(AT):

Human adipose tissue derived MSC

IFN-γ:

Interferon- gamma

IL-10:

Interleukin- 10

M:

Myofibroblasts

MMP:

Metalloproteinases

MSC:

Mesenchymal stromal cells

MSC-CM:

Mesenchymal stromal cells conditioned medium

P:

Myofibroblasts treated with primed MSC-CM

PCA:

Principal component analysis

PGE2:

Prostaglandin E2

PROCR:

Endothelial protein C receptor gene

R:

Myofibroblasts treated with resting MSC-CM

TGF-β:

Transforming growing factor- beta

TIMP:

Tissue inhibitors of metalloproteinases

TNF-α:

Tumor necrosis factor- alpha

TSG-6:

TNF-α- induced protein 6

α-SMA:

Alpha- smooth muscle actin

References

  1. Atabai K, Yang CD, Podolsky MJ. You say you want a resolution (of fibrosis). Am J Respir Cell Mol Biol. 2020;63(4):424–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Thannickal VJ, et al. Fibrosis: ultimate and proximate causes. J Clin Investig. 2014;124(11):4673–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Henderson NC, Rieder F, Wynn TA. Fibrosis: from mechanisms to medicines. Nature. 2020;587(7835):555–66.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Rozier P, et al. Extracellular vesicles are more potent than adipose mesenchymal stromal cells to exert an anti-fibrotic effect in an in vitro model of systemic sclerosis. Int J Mol Sci. 2021;22(13):6837.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Hall MC, et al. The comparative role of activator protein 1 and Smad factors in the regulation of Timp-1 and MMP-1 gene expression by transforming growth factor-beta 1. J Biol Chem. 2003;278(12):10304–13.

    Article  CAS  PubMed  Google Scholar 

  6. Juhl P, et al. Dermal fibroblasts have different extracellular matrix profiles induced by TGF-β, PDGF and IL-6 in a model for skin fibrosis. Sci Rep. 2020;10(1):17300.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Farge D, et al. Mesenchymal stromal cells for systemic sclerosis treatment. Autoimmun Rev. 2021;20(3): 102755.

    Article  CAS  PubMed  Google Scholar 

  8. Liang X, et al. Paracrine mechanisms of mesenchymal stem cell-based therapy: current status and perspectives. Cell Transplant. 2014;23(9):1045–59.

    Article  PubMed  Google Scholar 

  9. Krampera M, et al. Immunological characterization of multipotent mesenchymal stromal cells—The International Society for Cellular Therapy (ISCT) working proposal. Cytotherapy. 2013;15(9):1054–61.

    Article  PubMed  Google Scholar 

  10. Krampera M, Le Blanc K. Mesenchymal stromal cells: Putative microenvironmental modulators become cell therapy. Cell Stem Cell. 2021;28(10):1708–25.

    Article  CAS  PubMed  Google Scholar 

  11. Cheng A, et al. Human multipotent mesenchymal stromal cells cytokine priming promotes RAB27B-regulated secretion of small extracellular vesicles with immunomodulatory cargo. Stem Cell Res Ther. 2020. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13287-020-02050-6.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Kizilay Mancini O, et al. Age, atherosclerosis and type 2 diabetes reduce human mesenchymal stromal cell-mediated T-cell suppression. Stem Cell Res Ther. 2015;6(1):140.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Dominici M, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315–7.

    Article  CAS  PubMed  Google Scholar 

  14. Zhai L, et al. Quantification of IDO1 enzyme activity in normal and malignant tissues. Elsevier; 2019. p. 235–56.

    Google Scholar 

  15. Nejaddehbashi F, et al. Isolating human dermal fibroblasts using serial explant culture. Stem Cell Investig. 2019;6:23.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Younesi FS, et al. Myofibroblast markers and microscopy detection methods in cell culture and histology. Methods Mol Biol. 2021;2299:17–47.

    Article  CAS  PubMed  Google Scholar 

  17. Pakshir P, Hinz B. The big five in fibrosis: Macrophages, myofibroblasts, matrix, mechanics, and miscommunication. Matrix Biol. 2018;68–69:81–93.

    Article  PubMed  Google Scholar 

  18. Sabatier L, et al. Fibrillin assembly requires fibronectin. Mol Biol Cell. 2009;20(3):846–58.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Ahn S, et al. Engineered biomimetic fibrillar fibronectin matrices regulate cell adhesion initiation, migration, and proliferation via α5β1 integrin and syndecan-4 crosstalk. Adv Sci (Weinh). 2023;10(24): e2300812.

    Article  PubMed  Google Scholar 

  20. Vijayaraj P, et al. Modeling progressive fibrosis with pluripotent stem cells identifies an anti-fibrotic small molecule. Cell Rep. 2019;29(11):3488-3505.e9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Zhang R-M, Kumra H, Reinhardt DP. Quantification of Extracellular Matrix Fiber Systems Related to ADAMTS Proteins. New York: Springer; 2020. p. 237–50.

    Google Scholar 

  22. Psaroudis RT, et al. CD26 is a senescence marker associated with reduced immunopotency of human adipose tissue-derived multipotent mesenchymal stromal cells. Stem Cell Res Ther. 2022;13(1):358.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Kim D, et al. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907–15.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30.

    Article  CAS  PubMed  Google Scholar 

  26. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40.

    Article  CAS  PubMed  Google Scholar 

  27. Subramanian A, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545–50.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Mancini M, et al. The c-Rel transcription factor limits early interferon and neuroinflammatory responses to prevent herpes simplex encephalitis onset in mice. Sci Rep. 2021;11(1):21171.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Saul D, et al. A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. Nat Commun. 2022;13(1):4827.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Hao Y, et al. Integrated analysis of multimodal single-cell data. Cell. 2021;184(13):3573-3587.e29.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Perez-Riverol Y, et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 2022;50(D1):D543-d552.

    Article  CAS  PubMed  Google Scholar 

  32. Wollin L, et al. Antifibrotic and anti-inflammatory activity of the tyrosine kinase inhibitor nintedanib in experimental models of lung fibrosis. J Pharmacol Exp Ther. 2014;349(2):209–20.

    Article  PubMed  Google Scholar 

  33. Panizo S, et al. Fibrosis in chronic kidney disease: pathogenesis and consequences. Int J Mol Sci. 2021;22(1):408.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Shi Y, et al. Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases. Nat Rev Nephrol. 2018;14(8):493–507.

    Article  CAS  PubMed  Google Scholar 

  35. Loisel S, et al. Regulatory B cells contribute to the clinical response after bone marrow-derived mesenchymal stromal cell infusion in patients with systemic sclerosis. Stem Cells Transl Med. 2023;12(4):194–206.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Abraham Y, Zhang X, Parker CN. Multiparametric analysis of screening data: growing beyond the single dimension to infinity and beyond. J Biomol Screen. 2014;19(5):628–39.

    Article  PubMed  Google Scholar 

  37. Cabral-Pacheco GA, et al. The roles of matrix metalloproteinases and their inhibitors in human diseases. Int J Mol Sci. 2020;21(24):9739.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Choi A, et al. Anti-fibrotic effect of human wharton’s jelly-derived mesenchymal stem cells on skeletal muscle cells, mediated by secretion of MMP-1. Int J Mol Sci. 2020;21(17):6269.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Murphy G. Tissue inhibitors of metalloproteinases. Genome Biol. 2011;12(11):233.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Burnham AJ, et al. Differential response of mesenchymal stromal cells (MSCs) to type 1 ex vivo cytokine priming: implications for MSC therapy. Cytotherapy. 2023;25(12):1277–84.

    Article  CAS  PubMed  Google Scholar 

  41. Liu QW, et al. Human amniotic mesenchymal stem cells-derived IGFBP-3, DKK-3, and DKK-1 attenuate liver fibrosis through inhibiting hepatic stellate cell activation by blocking Wnt/β-catenin signaling pathway in mice. Stem Cell Res Ther. 2022;13(1):224.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Shao L, et al. Mesenchymal stromal cells can repair radiation-induced pulmonary fibrosis via a DKK-1-mediated Wnt/β-catenin pathway. Cell Tissue Res. 2021;384(1):87–97.

    Article  CAS  PubMed  Google Scholar 

  43. Yang Y, et al. EZH2-mediated repression of Dkk1 promotes hepatic stellate cell activation and hepatic fibrosis. J Cell Mol Med. 2017;21(10):2317–28.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Hamburg-Shields E, et al. Sustained β-catenin activity in dermal fibroblasts promotes fibrosis by up-regulating expression of extracellular matrix protein-coding genes. J Pathol. 2015;235(5):686–97.

    Article  CAS  PubMed  Google Scholar 

  45. Akhmetshina A, et al. Activation of canonical Wnt signalling is required for TGF-β-mediated fibrosis. Nat Commun. 2012;3:735.

    Article  PubMed  Google Scholar 

  46. Maeshima A, et al. Follistatin, an activin antagonist, ameliorates renal interstitial fibrosis in a rat model of unilateral ureteral obstruction. Biomed Res Int. 2014;2014: 376191.

    Article  PubMed  PubMed Central  Google Scholar 

  47. Wang Y, et al. Follistatin Attenuates Myocardial Fibrosis in Diabetic Cardiomyopathy via the TGF-β-Smad3 Pathway. Front Pharmacol. 2021;12: 683335.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Yao X, et al. Cathepsin S regulates renal fibrosis in mouse models of mild and severe hydronephrosis. Mol Med Rep. 2019;20(1):141–50.

    CAS  PubMed  PubMed Central  Google Scholar 

  49. Toyama S, et al. Decreased serum cathepsin S levels in patients with systemic sclerosis-associated interstitial lung disease. J Dermatol. 2020;47(9):1027–32.

    Article  CAS  PubMed  Google Scholar 

  50. Giri H, Biswas I, Rezaie AR. Activated protein C inhibits mesothelial-to-mesenchymal transition in experimental peritoneal fibrosis. J Thromb Haemost. 2023;21(1):133–44.

    Article  PubMed  Google Scholar 

  51. Horowitz JC, Thannickal VJ. Mechanisms for the Resolution of Organ Fibrosis. Physiology. 2019;34(1):43–55.

    Article  CAS  PubMed  Google Scholar 

  52. Muro AF, et al. An essential role for fibronectin extra type III domain A in pulmonary fibrosis. Am J Respir Crit Care Med. 2008;177(6):638–45.

    Article  CAS  PubMed  Google Scholar 

  53. Ricard-Blum S, Baffet G, Théret N. Molecular and tissue alterations of collagens in fibrosis. Matrix Biol. 2018;68–69:122–49.

    Article  PubMed  Google Scholar 

  54. Peters CA, et al. Dysregulated proteolytic balance as the basis of excess extracellular matrix in fibrotic disease. Am J Physiol. 1997;272(6 Pt 2):R1960–5.

    CAS  PubMed  Google Scholar 

  55. Rønnow SR, et al. Prolonged Scar-in-a-Jar: an in vitro screening tool for anti-fibrotic therapies using biomarkers of extracellular matrix synthesis. Respir Res. 2020;21(1):108.

    Article  PubMed  PubMed Central  Google Scholar 

  56. Bas A, et al. Understanding the development, standardization, and validation process of alternative in vitro test methods for regulatory approval from a researcher perspective. Small. 2021;17(15): e2006027.

    Article  PubMed  Google Scholar 

  57. Rosenbloom J, et al. Human fibrotic diseases: current challenges in fibrosis research. Methods Mol Biol. 2017;1627:1–23.

    Article  CAS  PubMed  Google Scholar 

  58. Noronha NDC, et al. Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res Ther. 2019. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13287-019-1224-y.

    Article  PubMed  PubMed Central  Google Scholar 

  59. Hinz B, Lagares D. Evasion of apoptosis by myofibroblasts: a hallmark of fibrotic diseases. Nat Rev Rheumatol. 2020;16(1):11–31.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We are grateful to Dr. Rong-Mo Zhang for his guidance on the ECM matrix analyses, and to Ms. Marie-Claude Moisan for her assistance with performing the nintedanib assays. We thank Dr Francis Rodier for providing the HCA2 hTERT cell line, and Dr James Martin for facilitating access to mouse lungs. We would like to thank the Centre for Translational Biology (CTB) Technology Platforms at the Research Institute of the MUHC.

Funding

CIHR# MOP125857 and the Fonds de dotation de l’AFER pour la recherche médicale (France).

Author information

Authors and Affiliations

  1. Division of Experimental Medicine, McGill University, Montreal, QC, Canada

    Marianela Brizio, Sydney Joy, Dominique Farge & Inés Colmegna

  2. Department of Microbiology and Immunology, McGill University, Montreal, QC, Canada

    Mathieu Mancini, Shirley Zhu, David Langlais & Inés Colmegna

  3. Department of Human Genetics, Dahdaleh Institute of Genomic Medicine, McGill University, Montreal, QC, Canada

    Mathieu Mancini, Benoit Brilland & David Langlais

  4. The Research Institute of the McGill University Health Centre (RI-MUHC), Montreal, QC, Canada

    Maximilien Lora & Inés Colmegna

  5. Service de Néphrologie-Dialyse-Transplantation, CHU Angers, Angers, France

    Benoit Brilland

  6. Univ Angers, Nantes Université, Inserm, CNRS, ICAT, CRCI2NA, Angers, SFR, France

    Benoit Brilland

  7. Faculty of Medicine and Health Sciences, Department of Anatomy and Cell Biology, McGill University, Montreal, QC, Canada

    Dieter P. Reinhardt

  8. Faculty of Dental Medicine and Oral Health Sciences, McGill University, Montreal, QC, Canada

    Dieter P. Reinhardt

  9. Internal Médicine Unit (04): CRMR MATHEC, Maladies Auto-Immunes Et Thérapie Cellulaire, AP-HP, Hôpital Saint-Louis, Université Paris Cité, Centre de Référence Des Maladies Auto-Immunes Systémiques Rares d’Ile-de-France, Paris, France

    Dominique Farge

  10. Division of Rheumatology, McGill University Health Centre, Montreal, QC, Canada

    Inés Colmegna

Authors
  1. Marianela Brizio
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Mathieu Mancini
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Maximilien Lora
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Sydney Joy
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Shirley Zhu
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Benoit Brilland
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Dieter P. Reinhardt
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Dominique Farge
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. David Langlais
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Inés Colmegna
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Marianela Brizio: Conception and design, collection of data, data analysis and interpretation, manuscript writing. Mathieu Mancini: Collection of data, data analysis and interpretation, manuscript writing. Maximilien Lora: Conception and design, data analysis and interpretation. Sydney Joy: Conception and design, data analysis and interpretation. Shirley Zhu: Collection of data, data analysis and interpretation. Benoit Brilland: Collection of data, data analysis and interpretation, manuscript writing. Dieter P. Reinhardt: Conception and design, data analysis and interpretation. Dominique Farge: Financial support, manuscript revision, input of critical intellectual content. David Langlais: Conception and design, data analysis and interpretation, manuscript revision, input of critical intellectual content. Inés Colmegna: Financial support, conception and design, data analysis and interpretation, final approval of manuscript.

Corresponding author

Correspondence to Inés Colmegna.

Ethics declarations

Ethics approval and consent to participate

Title of approved project: The Effects of Aging on Human Mesenchymal Stem Cells. Institutional approval committee: MUHC REB McGill University Health Centre Review Ethics Board. Approval number: 10–107 GEN. Date of approval: 2010–09-02. Renewal of Reviewing REB 2023–11-26. HCA2 hTERT foreskin fibroblasts were generously provided by Dr Rodier, University of Montreal who confirmed there was initial ethical approval for the collection of human cells and that donors signed informed consent.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Brizio, M., Mancini, M., Lora, M. et al. Cytokine priming enhances the antifibrotic effects of human adipose derived mesenchymal stromal cells conditioned medium. Stem Cell Res Ther 15, 329 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13287-024-03916-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13287-024-03916-9

Keywords

Stem Cell Research & Therapy

ISSN: 1757-6512