Skip to main content
Download PDF

Human dental follicle stem cell-derived exosomes reduce root resorption by inhibiting periodontal ligament cell pyroptosis

Stem Cell Research & Therapy volume 16, Article number: 79 (2025) Cite this article

Abstract

Background

To explore the therapeutic effects and mechanisms of the exosomes derived from dental follicle stem cells (DFSC-Exos) in reducing osteoclastogenesis and root resorption (RR) by inhibiting periodontal ligament cell (PDLC) pyroptosis.

Methods

DFSC-Exos, with force stimulation (Force-Exos) or without (Ctrl-Exos), were co-cultured with human PDLCs in vitro and injected into the periodontal ligament (PDL) of rats following the establishment of RR models in vivo. Subsequently, resorption volume, PDLC pyroptotic ratio, and NLRP3-mediated pyroptosis pathway activation were performed to investigate the therapeutic effects of DFSC-Exos on PDLC pyroptosis during RR. Furthermore, the number of M1/M2 macrophages, osteoclast formation, and transwell polarization elucidated the role of Force-Exo treatment in macrophage polarization and osteoclastogenesis by inhibiting pyroptosis. Exosomal miRNA sequencing and bioinformatic analysis were used to identify differentially abundant exosome-derived miRNAs, as well as the dominant biological processes and pathways modulated by miRNA. The administration of miRNA inhibitors further verified the regulation of exosomal miRNA on RR via modulating pyroptosis. Moreover, the potential mechanisms involving candidate miRNAs and relevant pathways were explored.

Results

Exosomes released by force-stimulated DFSCs (Force-Exos) inhibited NOD-like receptor 3 (NLRP3)-mediated PDLC pyroptosis, which impacted M1 macrophage activation and osteoclast formation. Based on exosomal miRNA sequencing, miR-140-3p in Force-Exos were transferred to PDLCs, and the administration of miR-140-3p inhibitors significantly reversed the reduction in PDLC pyroptosis, M1 macrophage polarization, osteoclast number, and resorption volume caused by Force-Exos. More importantly, mechanistic studies demonstrated that miR-140-3p mediated the function of Force-Exos by targeting DNA methyltransferase 1 (DNMT1) to alter the DNA methylation of suppressor of cytokine signaling (SOCS1) and the downstream nuclear factor κB (NF-κB) signaling pathway in PDLCs. Blocking the DNMT1/SOCS1/NFκB axis with DFSC-derived exosomal miR-140-3p downregulated NLRP3-mediated PDLC pyroptosis to impact M1 polarization and osteoclast formation, thereby alleviating RR.

Conclusion

DFSC-Exos downregulated NLRP3-mediated PDLC pyroptosis via miR-140-3p to block DNMT1/SOCS1/NFκB axis, which impacted M1 polarization and osteoclast formation, thereby alleviating RR.

Background

Root resorption (RR), a significant complication during dental treatment primarily caused by osteoclasts releasing osteolytic enzymes, endangers the longevity of the tooth, potentially impairing the masticatory function of patients and even leading to physical health issues such as malnutrition [1, 2]. It is now generally accepted that RR results from an aseptic inflammatory response in the periodontal ligament (PDL) under mechanical stimulation, ultimately resulting in the formation of osteoclasts and the destruction of dental hard tissues [3, 4]. Periodontal ligament cells (PDLCs) are considered the primary effector cells that receive mechanical stimulation, engaging in the conversion of mechanical signals into cellular signals, triggering the body’s immune reaction, and regulating cellular activity [5, 6]. Nonetheless, how to regulate the adverse immune response of PDLCs and improve the periodontal inflammatory microenvironment to reduce osteoclastogenesis and RR remains unclear. Furthermore, cell pyroptosis plays a pivotal role in the modulation of immunity, being involved in immoderate and continuous inflammation, causing intense immune responses [7]. Previously, our research demonstrated that mechanical forces activated PDLC pyroptosis, which released excessive inflammation cytokines IL-1β and IL-18, stimulating M1 macrophage polarization to increase osteoclastic formation and thereby promote RR [8]. Consequently, regulating PDLC pyroptosis may be essential for controlling and mitigating RR progression.

Exosomes are nanosized vesicles, 40 to 200 nanometers in diameter, which transport various molecules including microRNAs (miRNAs) between cells, playing a crucial role in intercellular communication [9]. The dental follicle stem cells (DFSCs) are particularly noteworthy with their abundant supply, robust self-renewal capacity, and close relationship with the development and function of PDLCs [10]. As reported, exosomes derived from DFSC (DFSC-Exos) have been shown to alleviate inflammation and facilitate the regeneration of periodontal tissues [11, 12]. Additionally, mechanical force can induce macrophage-derived exosomes to promote bone marrow mesenchymal stem cell osteogenesis [13]. Similarly, mechanical stress-induced myoblast-derived exosomes can also enhance osteogenesis [14]. However, the question remains unknown if exosomes from mechanically loaded DFSC can influence the function of PDLCs under force stimulation, potentially affecting osteoclast differentiation and RR.

Notably, miRNAs, a crucial component of exosomes, exert a profound influence on regulating pyroptosis and inflammatory responses [15]. Studies have demonstrated that miRNAs can orchestrate epigenetic modifications by modulating the levels of methyltransferases, which affects DNA methylation, controls transcription, and thereby impacts intercellular signaling pathways [16, 17]. Additionally, numerous studies have documented that methylation modifications contribute to the modulation of pyroptosis by altering the transcription of proteins associated with the pyroptosis pathway [18, 19]. Therefore, we hypothesize that DFSC-Exos may alleviate RR via miRNA delivered between cells modulating the DNA methylation status of cells and potentially inhibiting PDLC pyroptosis under mechanical stimulation.

Materials and methods

Cell culture and exosome isolation

The human dental follicle was obtained from 3 immature third molars (from 3 patients), and periodontal ligament tissue was obtained from the root surface of 6 extracted teeth (from 3 patients). These tissues were then digested in a 1:1 solution of collagenase type I and dispase II. The DFSCs and PDLCs were extracted and cultured as previously described [20]. PDLCs were subjected to compressive force of 2 g/cm² for 12 h by a coverslip layer and metallic weights on top as previously described [21].

Exosomes were isolated from the supernatant of DFSCs with mechanical stimulation (Force-Exo) or without compression force (Ctrl-Exos) by sequential ultracentrifugation as previously described [22]. DFSCs, with or without compression force, were washed with PBS twice and cultured in the serum-free medium for 48 h. The culture supernatants were centrifuged at 300 g for 10 min to remove dead cells and debris. Then successive centrifugations at 2,000 g for 10 min and 10, 000 g for 10 min were performed and pellets (cells, dead cells, cell debris) were discarded with the supernatant kept for the next step. After that, the supernatant was passed through a 0.22 μm filter and ultracentrifuged at 100,000 g for 2 h (Beckman Coulter, USA) to pellet the exosome vesicles. The final pellet containing exosomes was resuspended in PBS and stored at -80 ℃ until further use. PDLCs were treated with Ctrl-Exos or Force-Exos (100 μg/ml) for 24 h, then PDLCs were subjected to compressive force of 2 g/cm².

Animals and application of force

For in vivo studies, fifty-six male Wistar rats (10 weeks old, 250–280 g) were randomly assigned to 8 groups: (1) Ctrl + PBS group (n = 7), in which rats were subjected to PBS and devices without force application; (2) Force + PBS group (n = 7), in which rats were subjected to orthodontic force and PBS; (3) Force + Ctrl-exo group (n = 7), in which rats were subjected to orthodontic force and Ctrl-exo; (4) Force + Force-exo group (n = 7), in which rats were subjected to orthodontic force and Force-exo; (5) PBS + NC group (n = 7), in which rats were subjected to PBS and microRNA negative control (NC) and devices without force application; (6) Force + Ctrl-exo + NC group (n = 7), in which rats were subjected to orthodontic force, Ctrl-exo, and NC; (7) Force + Force-exo + NC group (n = 7), in which rats were subjected to orthodontic force, Force-exo, and NC; (8) Force + Force-exo + anti-miR-140-3p group (n = 7), in which rats were subjected to orthodontic force, Force-exo, and miR-140-3p inhibitor (anti-miR-140-3p).

To minimize stress and suffering, the animals were intraperitoneally administered a 3% (w/v) pentobarbital sodium salt solution. Following this, a closed-coil spring was applied between the left maxillary first molar and the incisor, exerting a force of 100 g (heavy force) for 21 days, with 0 g as the control [23]. Force-Exos and Ctrl-Exos (10 μL, 20 μg) were injected into the periodontal ligament tissue of the left maxillary first molar under mechanical stimulation every other day, using an equal volume of PBS injected into the same position as the control group [24]. Additionally, miR-140-3p inhibitor and negative control (0.5 nmol) were also injected into the periodontal ligament of each rat, one day before exosome injection, and administered every other day [25]. Finally, the animals were euthanized by spinal cord disruption.

DFSC and exosome characterization

After three passages, the cells were harvested for identification. For osteogenic and adipogenic differentiation, the cells were cultured in 6-well plates (1 × 105 cells/well). After reaching 80% confluency, the cells were orientated induced using osteogenic differentiation medium (Cyagen, China) and adipogenic differentiation medium (Cyagen, China) for 3 weeks, respectively. After differentiation, the cells were stained with Oil Red O and ALP, and observed under an inverted microscope (Olympus CKX53, Japan).

The surface markers of exosomes (CD9, CD63 and TSG101) were identified by western blot, loading with the same amount of exosome protein (60 μg).

Transmission electron microscopy (TEM) was used to detect the morphology of exosomes. The exosomes were resuspended with PBS and fixed with 2% glutaraldehyde for 1 h. Then, the mixture (about 10 μL) was placed on carbon-coated copper grids. The image was obtained by a HT7700 TEM (Hitachi, Japan) at 120 kV.

Particle size/concentration and particle distribution of exosomes were determined by nanoparticle tracking analysis (NTA). The isolated exosomes were recorded and analyzed by the Zetasizer Nano ZS analysis system (Zetasizer, UK).

The isolated Force-exos and Ctrl-exos were labeled with a membrane-labeling dye PKH26 (Life, USA), respectively, and were then washed and resuspended with a normal medium. Thereafter, PDLCs were cocultured with PKH26-labeled Force-exos and Ctrl-exos, respectively, for 0–24 h in confocal dishes. Then, PDLCs were washed with PBS three times, fixed in 10% formaldehyde for 15 min, and stained with phalloidin (Life, USA) and DAPI (Life, USA). The images were captured by confocal microscopy (Olympus FV1000, Japan).

In vitro co‑culture experiments

For miR-140-3p (UACCACAGGGUAGAACCACGG) inhibition, the PDLCs were transfected with microRNA control or miR-140-3p inhibitor (Ribobio, China) at a concentration of 50 nM by using Lipofectamine 3000 (Invitrogen, USA) for 24 h prior to be co-cultured with exosomes as described previously [26]. For miR-140-3p overexpression, PDLCs macrophages were transfected with microRNA control or miR-140-3p mimic at a concentration of 50 nM using Lipofectamine 3000 for 48 h prior to be co-cultured with exosomes [26].

The siRNA primer sequences for DNMT1 (5’-UUAUGUUGCUCACAAACUUCUUGUC-3’ (forward) and 5’-GACAAGAAGUUUGUGAGCAACAUAA-3’ (reverse)) were custom synthesized (Tsingke, China). Transfections were performed with Lipofectamine 3000 (Invitrogen, USA) for 24 h before force stimulation [26]. For DNMT1 inhibition, PDLCs were treated with 500 nM Decitabine (HY-A0004, MCE, USA) as described previously [26].

Micro-computed tomography (micro-CT) analysis

The maxillae of rats (sample size: 10 mm x 5 mm x 5 mm) were dissected out and immersed in a 4% formaldehyde solution for 48 h. Subsequently, the specimens were scanned using a high-resolution micro-CT 50 system (Scanco Medical, SUI) at 80 kV, 500 μA, and with a spatial resolution of 6 μm. Mimics 21.0 software (Materialise, Belgium) was used to reconstruct the three-dimensional model of the alveolar bone block with a threshold intensity of 3000 Hounsfield units (Fig. S3). To determine the severity of root resorption, the mesial root was separated and the total volume of the resorption pits at mesial surface of the mesial root was calculated using the mesial roots of left maxillary first molar on the contralateral side as the reference [8, 27]. Briefly, we firstly oriented the left maxillary first molar of all samples in the same direction [28]. Then, the experimental mesial root of left maxillary first molar was segmented at the height of root furcation and imported into 3-matic Research 13.0 (x64) Beta software (Materialise, Belgium) which could automatically calculate the volume of imported root data. The contralateral side of mesial root of left maxillary first molar was set as the control [27] using the same calculations. Thus, the differences between experimental and control root volume were defined as the total volume of resorption. In the animal experiments conducted in this study, since orthodontic traction force was applied in a single direction, compression force was produced and loaded mainly on a specific root surface, that is, the mesial surface. Thus, we speculated that root resorption primarily occurred on the mesial aspect of the root.

The amount of orthodontic tooth movement (OTM) was measured by the spacing between the cementum-enamel junction (CEJ) levels of the first and second left molars. In this study, a 200 μm × 200 μm × 600 μm cube of trabecular bone mesial to the middle part of the mesial root of the maxillary left first molar was selected as the region of interest for analysis. The distance between the cube and the root was 100 μm. Then, parameters including the bone volume/total volume (BV/TV) ratio, trabecular number (Tb.N) and trabecular spacing (Tb.Sp) were calculated at day 21 after OTM.

Histological, immunohistochemical and immunofluorescence staining

The maxillae (6 per group) were preserved in 4% paraformaldehyde for 48 h, followed by decalcification in 10% ethylenediaminetetraacetic acid (EDTA) for eight weeks. After decalcification, the specimens were embedded within a paraffin matrix and cut into 5-μm sections in a plane parallel to the mesial root of the first molar (12 slices per maxillae). The observers were blinded to the treatment group.

Osteoclasts were identified through tartrate-resistant acid phosphatase (TRAP, Sigma-Aldrich, USA) staining. Each slide was sealed with resinene and viewed under a light microscope. The number of TRAP-positive cells near the root surface in the compression side of the periodontal area was counted. The number of TRAP-positive cells on the compression side of the alveolar bone surface was also counted.

Immunohistochemical staining was performed to observe the expressions of IL-1β and IL-18 in the periodontal area. Tissue sections were heated at 95˚C for antigen retrieval for 30 min, washed three times with PBS for 5 min each, and blocked in 10% goat serum for 30 min at 37˚C. Then, the samples were incubated with rabbit anti-IL-1β (1:100; Cat# AF4006; Affinity) and rabbit anti-IL-18 (1:100; Cat# DF6252; Affinity) respectively at 4˚C overnight. The number of IL-1β and IL-18-positive cells was counted.

TUNEL staining was conducted to quantify apoptosis using the TUNEL apoptosis assay kit, following the manufacturer’s specified protocol (Beyotime, China). Slides were treated in a step-by-step manner with a pre-mixed TUNEL detection reagent composed of terminal deoxynucleotidyl transferase and FITC-dUTP in a 1:9 ratio. The apoptosis index was determined by dividing the number of TUNEL-positive cells by the total number of cells within a single field of view. Fluorescence signal detection was achieved using a laser confocal microscope.

The immunofluorescence staining samples were heated at 95˚C for antigen retrieval for 30 min, washed 3 times with PBS for 5 min each, and blocked in 10% goat serum for 30 min at 37˚C. Then, the samples were incubated with rabbit anti-NLRP3 (1:100, Cat# DF7438, Affinity, China), rabbit anti-Caspase1 (1:100, Cat# AF4005, Affinity, China), mouse anti-CD68 (1:100; Cat# MCA341GA, Bio-Rad, USA), rabbit anti-iNOS (1:100, Cat# BS1186, Bioworld, China), and rabbit anti-CD163 (1:100, Cat# BS71200, Bioworld, China) overnight at 4˚C. Then, slides were incubated with the Alexa Fluor 488 goat anti-rabbit (ZF-0511, 1:200, Zhongshan Bio-Tech, China) and Alexa Fluor 594 donkey anti-rabbit (ab150108, 1:200, Abcam, USA) respectively for 2 h at 37˚C and counterstained with DAPI (Sigma, USA) for 30 min. After three washes with PBS, stained sections were observed using fluorescent microscopy (DMI 6000; Leica, Germany). Quantitative analyses of the images were done by the Image-Pro Plus 6.0 Software (Media Cybernetics, USA).

Sequencing of exosomal miRNA and data analysis

The miRNeasy Serum/Plasma Kit (Qiagen) isolated the total RNA from Force-Exo/Ctrl-Exo samples, and the PCR products were sequenced by the BGISEQ-500 platform (BGI Group). The raw data obtained were analyzed to determine the differentially expressed miRNAs through a t-test. Those exhibiting a minimum of two-fold increase in expression and a P value < 0.05 were considered significantly different. Furthermore, pathway analysis was performed utilizing the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. A list of the 20 most significantly enriched pathways related to signaling transduction was compiled, which was employed to identify the most associated pathways.

Hoechst 33,342 /PI fluorescence staining

Cells were cultured on the coverslips in 12-well plates and stained with Hoechst 33,342 and propidium iodide (PI, Beyotime, China) at room temperature for 5 min to assess cell membrane integrity. The stained cells were then imaged using a fluorescence microscope (Olympus, Japan).

Flow cytometry

Cell harvesting was achieved through trypsinization, followed by washing twice with cold PBS. After centrifugation at 2000 r/min for 3 min, the supernatant was discarded and the cell pellet was resuspended in 1 × binding buffer at a density range of 1.0 × 105 to 1.0 × 106 cells per milliliter. 100 μL of the cell suspension was then transferred to a 5 mL culture tube and mixed with 5 μL of FITC-conjugated annexin V (Cat# 556547, BD Biosciences) and 5 μL of PI (Cat# 556547, BD Biosciences) at room temperature in the dark. The samples were analyzed by fluorescence-activated cell sorter (CytoFLEX S, Beckman Coulter, USA).

Enzyme-linked immunosorbent assay (ELISA)

The IL-1β concentration was tested from cultured supernatant of PDLCs using human IL-1β ELISA kit (Cat# EHC002b, Neobioscience, China) according to the instructions. The average IL-1β concentration was normalized to the blank group.

Transmission electron microscopy

The slices were embedded in epoxy resin and stained with 4% uranylacetate-0.3% lead citrate. The results were observed by using a HT7800 TEM (Hitachi, Japan) at 120 kV.

THP1 cell-derived macrophage transwell assay

THP1 cells (a human monocytic cell line) were added into the upper chamber of a co-culture system (Cat# 3401, Corning, USA; pore size: 0.4 μm; polycarbonate (PC) membrane) at 1 × 106 cells per well. This was followed by the application of phorbol myristate acetate (PMA, 50 ng/ml, Cat# P8139, Sigma, USA) for a duration of 72 h. Subsequently, PDLCs were dispensed into 12-well plates at a cell density of 1 × 105 cells per well and subjected to static compression forces at a magnitude of 2 g/cm2 for 12 h. Following two washes with PBS, the upper chamber was cultured with PDLCs that had been subjected to either mechanical force or treated with exosomes. The plates were then maintained at 37 °C for further 48 h. Subsequently, THP-1 cells were lysed to prepare for Western blot or qRT-PCR analysis.

THP1 cell-derived osteoclastogenesis

Cell culture supernatants were harvested from the treated PDLCs. THP1 cells were added at a density of 5 × 105 cells per well in 24-well plates with phorbol myristate acetate (PMA; 50 ng/mL; Cat# P8139; Sigma) for 72 h. The culture medium was switched to PDLC-conditioned supernatants supplemented with macrophage colony-stimulating factor (M-CSF; 50 ng/mL; Novoprotein) and receptor activator of nuclear factor-κB ligand (RANKL; 50 ng/mL; Novoprotein). Every two days, the supernatants were exchanged, and the cellular morphology was monitored for a consecutive 14-day period. TRAP staining and Western blot analysis were subsequently conducted.

Western blot assay

Western blotting was conducted as previously described [24]. Proteins from all samples were extracted using RIPA buffer (Cat# P0013B, Beyotime, China) for 30 min at 4 °C. The concentration of proteins was determined by BCA kit (Cat# P0010S, Beyotime, China). Subsequently, equal amounts of protein samples were separated via electrophoresis and then electro-transferred onto PVDF membranes (0.45 μm, Millipore, USA). Membranes were blocked with TBST containing 5% BSA for 1 h at ambient temperature. The following antibodies were incubated under 4 °C overnight: rabbit anti-NLRP3 (1:1000, Cat# DF7438, Affinity, China), rabbit anti-pro-Caspase1 (1:1000, Cat# AF5418, Affinity, China), rabbit anti-Caspase1 (1:1000, Cat# AF4005, Affinity, China), rabbit anti-GSDMD (1:1000, Cat# AF4012, Affinity, China), rabbit anti-pro-IL-1β (1:1000, Cat# AF5103, Affinity, China), rabbit anti-IL-1β (1:1000, Cat# AF4006, Affinity, China), rabbit anti-IL-18 (1:1000, Cat# DF6252, Affinity, China), rabbit anti-NFκB (1:1000, Cat# BS1254, Bioworld, China), rabbit anti-pNFκB (1:1000, Cat# BS1254P, Bioworld, China), rabbit anti-NFAT2 (1:1000, Cat# 183023, Abcam, China), rabbit anti-MMP9 (1:1000, Cat# ab76003, Abcam, China), rabbit anti-CTSK (1:1000, Cat# ab207086, Abcam, China), rabbit anti-SOCS1 (1:1000, Cat# BA2306, Boster, China), rabbit anti-DNMT1 (1:1000, Cat# ET1702-77, Huabio, China) and mouse anti-β-actin (1:5000, Cat# T0022, Affinity, China). After incubated with HRP-conjugated secondary antibodies (goat anti-mouse IgG, Cat# BA1051; goat anti‐rabbit IgG, Cat# BA1054, Boster, China) at room temperature for 1 h, the relative density was measured using ECL reagent (Cat# WBKLS0500, Millipore, China). The intensity of each band was visualized with a ChemiDoc Touch Imaging System (Bio-Rad, USA) and quantified after normalization to GAPDH with Image-Pro Plus 6.0 (Media Cybernetics, USA).

RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR)

The total RNA was extracted from the cells using Trizol reagent (Invitrogen, USA) through the manufacturer’s guidelines and then reverse-transcribed utilizing the Prime Script RT Reagent Kit with gDNA Eraser (Cat# RR047A, Takara, Japan) to generate complementary DNA (cDNA). The qRT-PCR was performed in 20 μl‐reactions using TB Green™ Premix Ex Taq™ II (Takara, Japan) and Real‐Time PCR System (QuantStudio 5, Applied Biosystems, USA). The relative expression levels of genes were normalized to GAPDH and calculated by the 2−ΔΔCt method. The mRNA primer (Tsingke, China) sequences used in this study were listed in Table S1.

Luciferase assay

Luciferase assay was conducted as previously described [29]. The 3’-untranslated region (3’-UTR) of the SOCS-1 sequence, which harbors the anticipated binding sites for miR-140-3p, along with its mutant version, was inserted into a plasmid vector and introduced into HEK293 cells. In the transfection experiments, a renilla luciferase vector was coinjected to serve as a control for assessing transfection efficiency. The luciferase activities were reported in relative light units (RLUs), calculated by dividing the mean photinus pyralis firefly luminescence by the mean activity of the renilla luciferase control vector.

Methylation-specific polymerase chain reaction (MSP)

The MSP assay was conducted as previously described [30]. To examine the genomic DNA from the tissues and cells, extraction was performed followed by bisulfite modification. Subsequently, the methylation status of the modified DNA was determined using MSP. Partially modified total DNA was conducted by PCR using primers specific to the methylated and unmethylated forms of the SOCS1 gene, which targets CPG-rich islands. The primers were as follows: bisulfite sequencing PCR-SOCS1, 5’-TTATTAGGGATTTTGTTCGGTTTC-3’ (forward) and 5’-CTAATCTTAACTCGAACTTCCCG-3’ (reverse). The PCR products were then separated and visualized via agarose gel electrophoresis. Image analysis of the gel was conducted using an imaging system integrated with the gel electrophoresis equipment.

Statistical analysis

Statistical analysis was conducted using the SPSS 22.0 software. Statistical comparison was performed using two-tailed Student’s t-test or one-way analysis of variance (ANOVA) with Tukey’s post hoc test. The significance level of P < 0.05 was considered statistically significant. Data were presented as the mean ± standard deviation (SD) by GraphPad Prism version 7. All experiments were repeated at least 3 times.

Results

Force-exos alleviate osteoclast-initiated RR by inhibiting PDLC pyroptosis and M1 polarization

To validate the efficacy of exosomes on osteoclastogenesis and RR, we established the model of rats induced by force for a period of 21 days, with Force-Exos and Ctrl-Exos (Fig. S1, S2) injected into the PDL every other day (Fig. 1A). HE staining showed hyaline layer (necrotic tissue resulting from the heavy compression of blood vessels in PDL) has disappeared leaving empty spaces. Through micro-computed tomography (micro-CT), the volume of resorption lacunae (Fig. S3) was reduced when treated with Force-Exo under force application (Fig. 1B). Tartrate-resistant acid phosphatase (TRAP) staining demonstrated a significant decrease in the number of osteoclasts after exosome treatment compared with the Force-PBS group, with the effect being further enhanced by Force-Exos (Fig. 1C, D, Fig. S4). In addition, no significant differences in tooth movement distance or bone mass were observed between the Force + PBS and Force + exos groups during bone remodeling (Fig. S4). The results suggest that Force-Exos exhibits a favorable therapeutic effect on osteoclast-mediated RR.

Fig. 1
figure 1

Force-Exos alleviate osteoclast-initiated RR by inhibiting PDLC pyroptosis and M1 polarization. (A) Diagram of the model used for RR and the schedule of exosome administration. Force-Exos and Ctrl-Exos were injected into the PDL of rats induced RR every other day. (B) Micro-CT demonstrates the resorption of the mesial root of the maxillary first molars. After injecting exosomes, the RR volume was significantly decreased and the Force-Exos enhanced the effect. Scale bar: 1 mm. n = 3. (C, D) TRAP staining reveals that the osteoclasts (black arrow, multinucleated TRAP+ cells) are predominantly distributed along the mesial compressive side. The number of osteoclasts exhibited a significant difference between Ctrl + PBS group and Force + PBS group. However, the increased osteoclast number was suppressed with the exosome treatment, especially Force-Exos. Scale bar: 50 μm. n = 6. (E) TUNEL staining indicates apoptosis or pyroptosis (green) of PDLCs in the root tip and mesial sides. The dashed line delineates the boundary of the PDL. The count of TUNEL-positive PDLCs was markedly downregulated following the exosomes injection and Force-Exos promoted the effect. Scale bar: 200 μm. n = 5. (F, G) Immunofluorescence staining of TUNEL/NLRP3 (TUNEL-green and NLRP3-red) (F) and TUNEL/caspase-1 (TUNEL-green and Caspase1-red) (G) reveals PDLC pyroptosis. The dashed line delineates the boundary of the PDL. Force-Exos significantly decreased PDLC pyroptosis compared with PBS and Ctrl-Exos. Scale bar: 50 μm. n = 5. (H) Immunohistochemical analysis shows the presence of IL-1β expression on the compression side of the mesial roots. The dashed line delineates the boundary of the PDL. Mechanical force increased the expression of IL-1β, which was substantially attenuated after exosomes were injected and Force-Exos showed a more significant inhibition than Ctrl-Exo. Scale bar: 50 μm. n = 6. (I) Immunohistochemical analysis reveals the expression of IL-18 on the compression side of the mesial roots. The dashed line delineates the boundary of the PDL. Force + Force-Exo group suppressed the expression of IL-18 compared with Force + PBS group and Force + Ctrl-Exo group. Scale bar: 50 μm. n = 6. (J, K) Immunofluorescence staining of CD68/iNOS (CD68-green and iNOS-red) (J) and CD68/CD163 (CD68-green and CD163-red) (K) demonstrates the co-localization of M1 and M2 macrophages. The dashed line delineates the boundary of the PDL. Treatment with exosomes resulted in a reduced number of M1 macrophages and an increased number of M2 macrophages and the effect was promoted by Force-Exos. Scale bar: 50 μm. (L) The quantities of M1 and M2 macrophages were subjected to statistical analysis, as well as the M1/M2 ratio. Force-Exos mitigated the M1/M2 ratio significantly in comparison to other groups. n = 5. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

To further investigate how DFSC-Exos inhibit osteoclastogenesis and RR, based on previous research, we conducted the TUNEL staining to evaluate the effects of DFSC-Exos on PDLC pyroptosis. The results demonstrated a notable increase in apoptotic or pyroptotic PDLCs under mechanical force and the effect was markedly downregulated subsequent to the injection of exosomes, especially Force-Exos (Fig. 1E). Similarly, through immunofluorescence staining for TUNEL/NOD-like receptor 3 (NLRP3) and TUNEL/caspase-1 co-localization, PDLC pyroptosis was also significantly decreased by Ctrl-Exos compared with PBS, and Force-Exos promoted the impact (Fig. 1F, G). In addition, immunohistochemical analysis indicated that DFSC-Exos mitigated the expression of IL-1β and IL-18 associated with pyroptosis, which was augmented following the application of force (Fig. 1H, I). Concurrently, to gain further insight into the impacts of exosomes on macrophages involved in osteoclast formation, we employed immunofluorescence dual staining which revealed that DFSC-Exos decreased the number of CD68+ iNOS+ M1 macrophages but increased the number of CD68+ CD163+ M2 macrophages, with a suppressive effect on the M1/M2 macrophage ratio (Fig. 1J, K, L). Furthermore, co-localization also shows that the effect of Force-Exos on macrophage polarization was more pronounced than that of Ctrl-Exos (Fig. 1J, K, L). These results suggested that Force-Exos could reduce PDLC pyroptosis, which affected M1 polarization and the generation of osteoclasts, ultimately alleviating osteoclast-initiated RR.

Force-Exos block NLRP3-mediated PDLC pyroptosis to reduce M1 polarization and osteoclast formation

We next co-cultured exosomes with PDLCs to further confirm the effect of DFSC-Exos on inhibiting PDLC pyroptosis in osteoclastogenesis (Fig. 2A). Immunofluorescence staining clearly showed that Ctrl-Exos and Force-Exos surrounded PDLC nuclei, suggesting that they had been taken up by PDLCs (Fig. 2B, Fig. S5). Furthermore, the PDLC pyroptotic ratio was conducted through Hoechst/PI staining and flow cytometry. Compared with PBS, pyroptotic cells significantly decreased after treatment with exosomes, especially Force-Exos (Fig. 2C, D). Meanwhile, IL-1β secretion was suppressed as a pyroptotic product through enzyme-linked immunosorbent assay (ELISA) and the protein levels of NLRP3, pro-caspase-1, caspase-1, GSDMD, GSDMD-N, pro-IL-1β, IL-1β and IL-18 associated with pyroptosis were downregulated through Western blot, indicating DFSC-Exos may modulate NLRP3-mediated signaling pathway to affect PDLC pyroptosis and Force-Exos enhanced the effect (Fig. 2E, F). Similarly, transmission electron microscopy results demonstrated that the cell membranes remained relatively intact following Force-Exo treatment compared with pyroptotic PDLCs in Force + PBS group (Fig. 2G).

Fig. 2
figure 2

Force-Exos block NLRP3-mediated PDLC pyroptosis to reduce M1 polarization and osteoclast formation. (A) Scheme of co-culture system. Exosomes were isolated from DFSCs with or without mechanical stimulation and co-cultured with PDLCs. (B) Intracellular localization of exosomes in PDLCs. Exosomes were labeled with PKH26 (red). PDLC cytoskeleton was stained with Phalloidin (green) and nuclei were counterstained with DAPI (blue). Subsequent to co-culturing exosomes with PDLCs, the fluorescence assays indicated the endocytosis of PDLCs on exosomes. Scale bar: 50 μm. (C) Hoechst 33,342 and propidium iodide (PI) fluorescence staining revealed that force upregulated the number of PI-positive cells (pyroptotic cells), which was downregulated by exosomes, especially Force-Exos. Scale bar: 50 μm. n = 5. (D) Flow cytometry showed the number of Annexin V+PI+ cells (pyroptotic cells) apparently decreased in Force + Force-Exo group, compared with Force + PBS group and Force + Ctrl-Exo group. Scale bar: 50 μm. n = 5. (E) Enzyme-linked immunosorbent assay showed IL-1β levels increased under mechanical stimulation, which was significantly suppressed after the exosome treatment and Force-Exos promoted the effect. n = 4. (F) The Western blot analysis indicated exosomes reduced the protein expression levels of NLRP3, pro-caspase-1, caspase-1, GSDMD, GSDMD-N, pro-IL-1β, IL-1β and IL-18. Force-Exos significantly enhanced the effect. Full‑length blots are presented in Fig. S6: Fig. 2F. (G) Ultrastructural comparison by transmission electron microscopy among Force + PBS and Force + Force-Exo groups. In contrast to the disappeared chromatin and non-viable mitochondria in Force + PBS group (red arrow), cell membrane in Force + Force-Exo group was relatively intact and chromatin condensed (blue arrow). Scale bar: 2 μm. (H) The qRT-PCR demonstrated exosomes significantly decreased the mRNA level of M1 markers including iNOS, TNF-α, IL-1β, whereas the mRNA level of M2 markers including CD163, Arg-1 and IL-4R was increased. Moreover, Force-Exos pronounced the impact, which was consistent with the efficacy of MCC950. n = 5. (I) Flow cytometry showed that the ratio of CD11b+ CD86+ cells (M1 macrophages) to CD11b+ CD206+ cells (M2 macrophages) was reduced in the Force + Force-Exo group and Force + MCC950 group, compared with other groups. n = 5. (J) The Western blot analysis revealed that the utilization of Force-Exos markedly diminished the protein expression levels of osteoclast markers (NFAT2, MMP9, CTSK), analogous to the efficacy of MCC950. Full‑length blots are presented in Fig. S6: Fig. 2J. (K) TRAP staining revealed the number of TRAP-positive osteoclasts decreased after treatment with exosomes and MCC950, and Force-Exos promoted the reduction. Scale bar: 200 μm. n = 5. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

We further found that inhibiting NLRP3-mediated PDLC pyroptosis by exosomes could modulate macrophages and osteoclasts to reduce RR. Through qRT-PCR and flow cytometry, Force-Exos could dramatically downregulated the force-increased expression of M1 macrophages and upregulate the force-decreased expression of M2 macrophages, concomitantly diminishing the ratio of M1/M2 macrophages (Fig. 2H, I). Similar results were observed after treatment with MCC950, a specific inhibitor of the NLRP3 inflammasome (supramolecular complex of activating caspase-1 in pyroptosis). Moreover, Force-Exos significantly suppressed the osteoclastic differentiation through TRAP staining and reduced compression-induced expression of osteoclast markers (NFAT2, MMP9 and CTSK), which was consistent with MCC950 (Fig. 2J, K). Collectively, the data indicated that Force-Exos reduced osteoclast-initiated RR by blocking the NLRP3-mediated PDLC pyroptosis which impacted M1 polarization and osteoclast formation.

Force-Exos transfer mir-140-3p to inhibit NLRP3-mediated PDLC pyroptosis

Since exosomes may exert the function by transferring miRNA related to pathogenic pathways, we performed miRNA analysis of DFSC-Exos and determined miR-140-3p which increased by ≥ twofold in Force-Exos compared with that in Ctrl-Exos (Fig. 3A, B). Moreover, the nuclear factor κB (NF-κB) signaling pathway was observed within the 20 most enriched signaling pathways associated with highly expressed miRNAs (Fig. 3C). Through qRT-PCR, we found that the expression of miR-140-3p was significantly decreased in mechanically stimulated DFSCs and increased in Force-Exos, as well as dramatically upregulated by Force-Exos in PDLC (Fig. 3D). These findings indicated that miRNA-140-3p could be transferred from DFSCs to PDLCs through exosomes, especially Force-Exos, and may modulate NF-κB signaling pathway to impact PDLC pyroptosis during RR.

Fig. 3
figure 3

Force-Exos transfer miR-140-3p to inhibit NLRP3-mediated PDLC pyroptosis. (A) Scheme of exosome extraction and miRNA analysis. (B) Heat map of exosomal miRNA-seq (n = 3). The fluorescence intensity of 25 differently expressed miRNAs (≥ twofold) was represented from high (red) to low (blue). (C) KEGG (Kyoto Encyclopedia of Genes and Genomes) analyzed the 20 most enriched signaling transduction pathways associated with differentially expressed miRNAs, in which NF-κB signaling pathway was observed. (D) Expression of miR-140-3p in DFSCs with or without mechanical stimulation (left), in Ctrl-Exos or Force-Exos derived from DFSC (middle) and in PDLCs induced by PBS/Ctrl-Exos/Force-Exos (right). n = 5. (E) Hoechst 33,342 and PI fluorescence staining showed that the inhibition of miR-140-3p significantly increased PI-positive cells compared with Force + Force-Exo + NC group. Scale bar:50 μm. n = 5. (F) Flow cytometry revealed the PDLC pyroptotic ratio was promoted after miR-140-3p inhibition in Force-Exos, whereas Force-Exos without miR-140-3p inhibitors exhibited an inhibitory effect on PDLC pyroptosis. n = 4. (G) Western blot results indicated that Force-Exos with miR-140-3p inhibition upregulated the protein levels of NF-κB, NLRP3, pro-caspase-1, caspase-1, GSDMD, GSDMD-N, pro-IL-1β, IL-1β and IL-18 in PDLCs, antithetical to the effects of Force-Exos. Full‑length blots are presented in Fig. S6: Fig. 3G. (H) Analysis of cell supernatants for IL-1β levels by ELISA showed IL-1β secretion was upregulated after the inhibition of miR-140-3p in Force-Exos, compared with Force + Force-Exo + NC group. n = 4. (I) The qRT-PCR indicated that Force-Exos with miR-140-3p inhibitors upregulated the mRNA expression of M1 macrophage and downregulated the mRNA expression of M2 macrophage compared with Force-Exos. n = 3. (J) Flow cytometry presented the ratio of M1/M2 macrophages decreased after treatment with Force-Exos, which was upregulated after miR-140-3p inhibition in Force-Exos. (K) Western blot results showed that miR-140-3p inhibitors reversed the inhibitory effect of Force-Exos on the protein level of NFAT2, MMP9 and CTSK (osteoclast markers). Full‑length blots are presented in Fig. S6: Fig. 3K. (L) TRAP staining showed the number of TRAP-positive osteoclasts was significantly increased by Force-Exos with miR-140-3p inhibitors compared with Force + Force-Exo + NC group. Scale bar: 100 μm. n = 5. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

To confirm the hypothesis, miR-140-3p inhibitors were employed to transfect mechanically stimulated PDLCs treated with Force-Exos. Hoechst/PI staining and flow cytometry results showed an apparent increase in the number of pyroptotic cells in Force + Force-Exo + anti-miR-140-3p group compared with Force + Force-Exo + NC group (Fig. 3E, F). Meanwhile, miR-140-3p inhibitors significantly reversed the downregulation of NFκB and other protein expression related to NLRP3-mediated PDLC pyroptosis in Force + Force-Exo + NC group (Fig. 3G). The inhibition of miR-140-3p in Force-Exos increased IL-1β secretion through ELISA (Fig. 3H). Furthermore, the regulatory effects of miR-140-3p on macrophages and osteoclasts were conducted. When miR-140-3p was inhibited in Force-Exos, we observed an increase in M1 macrophages and a reduction in M2 macrophages, as well as enhanced M1/M2 macrophage ratio (Fig. 3I, J). In addition, osteoclast formation was promoted by Force-Exos with miR-140-3p inhibition (Fig. 3K, L). These results demonstrated that Force-Exo delivered miR-140-3p to inhibit NLRP3-mediated PDLC pyroptosis, ultimately reducing M1 polarization and osteoclast formation.

Exosomal mir-140-3p reduces osteoclastogenesis by inhibiting PDLC pyroptosis and reversing M1/M2 ratio

Exosomes with or without miR-140-3p inhibitors were injected into the RR rat models to further determine whether miR-140-3p in exosomes could regulate PDLC pyroptosis during osteoclast-mediated RR (Fig. 4A). Micro-CT and TRAP staining showed miR-140-3p inhibitors significantly increased the RR volume and the TRAP+ osteoclasts following Force-Exos administration, but barely affected OTM distance or bone mass, which indicated that miR-140-3p was required for exosomes improving osteoclastogenesis and RR (Fig. 4B, C, D, Fig. S4).

Fig. 4
figure 4

Exosomal miR-140-3p reduces osteoclastogenesis by inhibiting PDLC pyroptosis and reversing M1/M2 ratio. (A) The schedule of administration for miR-140-3p inhibitors and exosomes. (B) Micro-CT demonstrates Force-Exos with miR-140-3p inhibitors significantly increased the RR volume, which was reduced by Force-Exos. Scale bar: 1 mm. n = 4. (C, D) TRAP staining of osteoclasts reveals the. Compared with Force + Force-Exo + NC group, TRAP+ osteoclasts were increased by Force-Exos with miR-140-3p inhibitors. Scale bar: 50 μm. n = 6. (E) TUNEL staining indicates apoptosis or pyroptosis (green) of PDLCs in the root tip and mesial sides. The dashed line delineates the boundary of the PDL. The count of TUNEL-positive PDLCs was upregulated following the inhibition of miR-140-3p, while Force-Exos without miR-140-3p inhibitors downregulated apoptosis or pyroptosis of PDLCs. Scale bar: 200 μm. n = 5. (F, G) Immunofluorescence staining for TUNEL/NLRP3 (F) and TUNEL/caspase-1 (G) co-localization shows the PDLC pyroptosis. The dashed line delineates the boundary of the PDL. Force-Exos with miR-140-3p inhibition significantly increased the PDLC pyroptosis compared with Force + Force-Exo + NC group. Scale bar: 50 μm. n = 5. (H, I) The level of IL-1β (H) and IL-18 (I) on the compression side of the mesial roots was increased in Force + Force-Exos + anti-miR-140-3p group, which was decreased in Force + Force-Exo + NC group. Scale bar: 50 μm. n = 6. (J, K) Immunofluorescence staining of CD68/iNOS (CD68-green and iNOS-red) (J) and CD68/CD163 (CD68-green and CD163-red) (K) demonstrates the co-localization of M1 and M2 macrophages. The dashed line delineates the boundary of the PDL. The inhibition of miR-140-3p resulted in more M1 macrophages and fewer M2 macrophages and the effect was reversed by Force-Exos. Scale bar: 50 μm. (L) The quantities of M1 and M2 macrophages were subjected to statistical analysis, as well as the M1/M2 ratio. Force-Exos with miR-140-3p inhibition upregulated the M1/M2 ratio significantly in comparison to Force + Force-Exo + NC group. n = 5. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

TUNEL staining showed an increased ratio of apoptotic or pyroptotic PDLC in the Force + Force-Exo + anti-miR-140-3p group (Fig, 4E). Meanwhile, Force-Exos with miR-140-3p inhibitors upregulated the number of double-stained PDLCs compared with Force + Force-Exo + NC group through immunofluorescence analysis, suggesting that miR-140-3p played a crucial role in alleviating PDLC pyroptosis (Fig, 4 F, G). The increased levels of downstream IL-1β and IL-18 by miR-140-3p inhibitors further revealed that miR-140-3p in Force-Exos downregulated inflammation related to pyroptosis (Fig. 4H, I). Additionally, the inhibition of miR-140-3p in Force-Exos increased CD68+iNOS+ M1 macrophages and decreased CD68+CD163+ M2 macrophages, as well as reducing M1/M2 macrophage ratio in PDL through immunofluorescence double staining, while the effect on macrophage polarization was reversed by Force-Exos without miR-140-3p inhibitors (Fig. 4J, K, L). The data strongly confirmed that exosomal miR-140-3p could effectively alleviate osteoclast-initiated RR by inhibiting PDLC pyroptosis and reverse M1/M2 ratio.

Exosomal mir-140-3p inhibits PDLC pyroptosis by regulating DNA methylation via DNMT1/SOCS1/NFκB axis

To further explore the mechanism by which miR-140-3p modulated NLRP3-mediated PDLC pyroptosis during osteoclastogenesis and RR, we first evaluated the level of suppressor of cytokine signaling (SOCS1, a negative regulator of NF-κB signaling pathway) and found that mechanical stimulation significantly downregulated mRNA levels and protein expression of SOCS1, as well as upregulated the level of NFκB and pNFκB, determining the negative regulation of SOCS1 on PDLC pyroptosis through qRT-PCR and Western blot (Fig. 5A, B). Knowing that pyroptosis could be impacted by methylation modification, we hypothesized the potential involvement of DNA methylation in the level of SOCS1. Through Methylation-specific polymerase chain reaction (MSP), the methylation level of CpG island in SOCS1 promoter region in PDLCs was markedly elevated under mechanical stimulation (Fig. 5C). To investigate the specific mechanism of SOCS1 DNA methylation related to forced PDLC pyroptosis, we focused on DNMT1 (DNA methyltransferase 1), a prominent member of the DNMT family, which could maintain DNA methylation for gene silencing. Through qRT-PCR, we found that both Decitabine (inhibitor of DNA methyltransferase) and DNMT1 siRNA significantly increased the mRNA level of SOCS1 (Fig. 5D). Meanwhile, after administration for Decitabine or si-DNMT1, downregulated DNA methylation and upregulated protein expression of SOCS1 were observed with reduced NFκB protein level through Western blot and MSP, indicating that DNA methylation inhibition could alleviate PDLC pyroptosis via modulating DNMT1/SOCS1/NFκB axis (Fig. 5E, F, G, H).

Fig. 5
figure 5

Exosomal miR-140-3p inhibits PDLC pyroptosis by regulating DNA methylation via DNMT1/SOCS1/NFκB axis. (A) The qRT-PCR showed that mRNA level of SOCS1 in rat PDL was significantly suppressed under mechanical stimulation. n = 6. (B) Western blot results revealed that force downregulated the protein level of SOCS1 and upregulated the expression of NFκB and pNFκB. Moreover, SOCS1 siRNA increased NFκB level, suggesting that SOCS1 was a negative regulator of NF-κB signaling pathway. Full‑length blots are presented in Fig. S7: Fig. 5B. (C) MSP shows the methylation level of SOCS1 promoter in PDLCs. Force upregulated the DNA methylation level of SOCS1. Full-length gels are presented in Fig. S7: Fig. 5C. (D) The qRT-PCR showed that Decitabine (inhibitor of DNA methyltransferase) and DNMT1 siRNA significantly increased mRNA level of SOCS1 in mechanically stimulated PDLCs. n = 6. (E) Western blot analysis indicated that decitabine downregulated DMNT1, NFκB and pNFκB expression, but upregulated the protein level of SOCS1. Full‑length blots are presented in Fig. S7: Fig. 5E. (F) MSP results showed that DNA methylation of SOCS1 was suppressed in Force + Decitabine group compared with Force + PBS group. Full-length gels are presented in Fig. S7: Fig. 5F. (G) Western blot results revealed that si-DNMT1 increased SOCS1 expression but decreased DMNT1, NFκB and pNFκB levels. Full‑length blots are presented in Fig. S7: Fig. 5G. (H) MSP showed that si-DNMT1 administration decreased the DNA methylation level of SOCS1. Full-length gels are presented in Fig. S7: Fig. 5H. (I) Sequence alignment between miR-140-3p and its putative binding sites (in red letters) in the DNMT1. Mutation of the miR-140-3p target sites (in blue letters) was also shown. Luciferase reporter assay for the relative luciferase activities of WT and Mut DNMT1 indicated that luciferase activity was significantly reduced by miR-140-3p overexpression in DNMT1-3’UTR WT group. n = 4. (J) Western blot analysis demonstrated that overexpression of miR-140-3p suppressed both DMNT1, NFκB and pNFκB levels, but upregulated the protein level of SOCS1. Full‑length blots are presented in Fig. S7: Fig. 5J. (K) The qRT-PCR showed decreased mRNA level of DNMT1 and NFκB, as well as increased SOCS1 level with miR-140-3p overexpressed. n = 6. (L) Western blot results showed that exosomes downregulated DMNT1, NFκB and pNFκB levels, and upregulated SOCS1 expression. Force-Exos exhibited a more significant effect than Ctrl-Exos. Full‑length blots are presented in Fig. S7: Fig. 5L. (M) Western blot analysis revealed that the inhibition of miR-140-3p in Force-Exos significantly increased SOCS1 expression but suppressed DMNT1, NFκB and pNFκB levels. Full‑length blots are presented in Fig. S7: Fig. 5M. (N) Schematic illustration of exosomal miR-140-3p playing crucial roles in the prevention and treatment of RR. PDLCs exhibit elevated expression of DNMT1 in response to mechanical stimulation, and increased DNMT1 reduces the protein level of SOCS1 by upregulating DNA methylation to impact transcription. The inhibition of SOCS1 level, as a negative regulator in the NFκB signaling pathway, facilitates the assembly of the NLRP3 inflammasome which promotes the activation of caspase-1. Subsequently, pro-IL-1, pro-IL-18, and GSDMD are cleaved into mature forms by activated caspase-1. The GSDMD-N terminal region facilitates the formation of cell membrane pores, resulting in cell membrane rupture and the release of contents including IL-1β and IL-18, which leads to inflammatory microenvironment that directly stimulates osteoclast formation or indirectly enhances M1 polarization and inhibits M2 polarization to promote osteoclastogenesis. Furthermore, within exosomes from the supernatant of mechanically forced DFSCs (Force-Exo), miRNA-140-3p is significantly overexpressed. When treating force-induced RR with Force-Exo, DFSC-derived exosomal miRNA-140-3p targets DNMT1 to downregulate DNA methylation and upregulate protein expression of SOCS1, which decreases the levels of NFκB and downregulates NLRP3-mediated PDLC pyroptosis to reduce M1 polarization, thereby suppressing osteoclast formation and RR

Full size image

Moreover, we wondered how exosomal miR-140-3p affected the function of DNMT1 to regulate DNMT1/SOCS1/NFκB axis and pyroptosis. Bioinformatics analysis demonstrated that miR-140-3p may conserve the binding sites in the 3’UTR of DNMT1 (Fig. 5I). To validate the bioinformatic prediction, we conducted a dual-luciferase reporter assay and found that miR-140-3p overexpression distinctly decreased luciferase activity in DNMT1-3’UTR WT group, while that in DNMT1-3’UTR Mut group remained unchanged (Fig. 5I). The qRT-PCR and Western blot showed that overexpression of miR-140-3p suppressed both the mRNA and protein levels of DNMT1 and NFκB, but upregulated SOCS1 level (Fig. 5J, K). In addition, we next confirmed exosomal miR-140-3p could inhibit PDLC pyroptosis by DNMT1/SOCS1/NFκB axis. Force-Exos and Ctrl-Exos significantly decreased the levels of DNMT1 and NFκB, but increased SOCS1 expression (Fig. 5L). However, the impacts were reversed following the inhibition of miR-140-3p in Force-Exos (Fig. 5M). All these data demonstrated that mechanically stimulated DFSC-derived exosomal miRNA-140-3p targeted DNMT1 and modulated DNMT1/SOCS1/NFκB axis, which downregulated NLRP3-mediated PDLC pyroptosis to reduce M1 polarization, thereby suppressing osteoclast formation and RR (Fig. 5N).

Discussion

Root resorption remains a significant clinical challenge in dental treatment, initiated primarily by osteoclasts. Various signaling pathways related to inflammation have been studied in this context [31]. Pyroptosis, a crucial component of innate immunity, promotes the release of pro-inflammatory factors such as IL-1β and IL-18, thus sustaining an inflammatory microenvironment [32]. Research indicates that IL-1β can enhance osteoclast formation by inducing osteoblasts to express the receptor activator of NF-κB ligand [33]. Additionally, IL-18 and IL-12 work together to inhibit TNF-α-mediated osteoclastogenesis in vitro [34]. Both IL-1β and IL-18 are known to increase M1 polarization while decreasing M2 polarization [35, 36], and a higher M1/M2 macrophage ratio boosts osteoclast formation [27]. Our study therefore focused on inhibiting PDLC pyroptosis to improve the inflammatory microenvironment, consequently suppressing osteoclastogenesis and M1 macrophage polarization to directly or indirectly reduce RR.

In recent years, exosomes, an important paracrine pathway, are recognized as a potent therapeutic tool through intercellular signal transmission [37]. Notably, exosomes derived from mesenchymal stem cells (MSCs) have been applied in treatment by regulating inflammatory responses and osteoclast formation. For instance, dental pulp stem cell-derived exosomes modulated the anti-inflammatory and osteogenic potential in PDLCs. Exosomes from TNF-α-treated human gingiva-derived MSCs prevent bone loss and induce macrophage polarization [26]. Compared with other MSCs, DFSCs possess multilineage differentiation potential, superior anti-inflammatory properties and accessibility to obtain, thereby laying the groundwork for their clinical application [38]. Studies indicated DFSCs could reprogram macrophages into the anti-inflammatory M2 phenotype to alleviate LPS-induced inflammation [39]. Meanwhile, DFSC-Exos could promote the proliferation, migration, and osteogenic abilities of PDLCs [12]. Thus, we concentrated on DFSCs-Exos and found that DFSC-Exos, especially Force-Exos, reduced RR by inhibiting NLRP3-mediated PDLC pyroptosis to downregulate M1 polarization and osteoclast formation.

We further explored how exosomes improved the inflammatory environment to regulated RR. Notably, studies indicated that the promoter regions of genes involved in inflammatory activation displayed DNA hypomethylation in gingival tissues from periodontitis patients [40]. The DNA hypomethylation of MMP genes contributes to macrophage-mediated innate immunity by boosting M1 polarization [41]. Furthermore, the signaling pathways related to osteoclast differentiation and activity were influenced by the DNA methylation level of genes [42, 43]. Hence, we hypothesize that exosomal miRNA may modulate inflammation to reduce RR through DNA methylation.

In our studies, it was demonstrated that the macrophage polarization and osteoclast differentiation were regulated by inflammatory factors associated with pyroptosis. After MCC950 injection, we further found the effect on M1 polarization was not as obvious as Force + Force-Exo group, which may be attributed to the presence of other pathways to impact macrophage. Relevant studies showed that some miRNA such as miR-155, miR-127 and miR-125b played roles in driving macrophage polarization [44]. Meanwhile, PDLC-derived exosomes carried miR-590-3p into macrophages to reduce macrophage pyroptosis by inhibiting TLR4 transcription [45]. Exosomal miR-143-3p from inflammatory periodontal ligament stem cells facilitated M1 macrophage polarization [46]. The results suggested that the specific mechanism of exosomes on the polarization of macrophages needs to be further explored.

More importantly, through inhibiting NLRP3-mediated PDLC pyroptosis via DNMT1/SOCS1/NFκB axis with exosome administration, we found force-induced RR, osteoclast activity and M1/M2 macrophage ratio were effectively blocked, but the results of OTM rate and bone mass analyses revealed that required bone remodeling during OTM may not be interrupted. Especially, we investigated TRAP-positive osteoclast number under force applying exosome and observed a reduction in osteoclast numbers on the bone surface, mirroring the decrease in osteoclast numbers on the root surface. This finding aligns with our previous results, where inhibiting PDLC pyroptosis pathways with MCC950 alleviated RR without affecting OTM [8]. We propose that excessive orthodontic forces induce tooth movement and bone remodeling primarily through undermining resorption. In this process, following hyaline degeneration within the periodontal tissue, osteoclasts predominantly mediate bone resorption within the bone marrow cavity adjacent to the hyaline zone (which differs from frontal resorption that occurs on the surface of the alveolar bone). The undermining resorption must be completed before the tooth can move [47]. Since Force-exo improved the inflammatory microenvironment, reducing osteoclasts on the bone surface, but has limited impact on the osteoclasts within the bone marrow cavity participating in undermining resorption, thus not impeding tooth movement or alveolar bone remodeling. Moreover, we hypothesize that the rate of bone remodeling for tooth movement also relies on the activities of both osteoclasts and osteoblasts [48]. Blocking pyroptosis or other inflammatory pathways reduces inflammation-induced damage to osteoblasts, thereby preserving their function in the inflammatory microenvironment, which supports tooth movement. Additionally, permanent RR with late damage depends not only on osteoclast destruction but also on the repair activity of osteoblasts [49]. Suppressing inflammation in the periodontal microenvironment can decrease functional impairment of osteoblasts, aiding in root repair and minimizing RR.

Conclusions

In summary, we proposed an innovative approach by utilizing mechanically stimulated DFSC-derived exosomes to alleviate osteoclast-mediated RR through regulating PDLC pyroptosis. Furthermore, we discovered that the precise mechanism involved exosomal overexpressed miR-140-3p influencing PDLC pyroptosis through the DNMT1/SOCS1/NFκB axis, which affected M1 macrophage polarization and osteoclast formation, thereby effectively preventing RR. This study highlights the exosome-mediated modulation of epigenetic inheritance to ameliorate periodontal inflammatory microenvironment, offering a promising avenue for the prevention and treatment of osteoclast-initiated RR.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.

References

  1. Iglesias-Linares A, Hartsfield JK Jr. Cellular and molecular pathways leading to external root resorption. J Dent Res. 2017;96(2):145–52.

    Article  CAS  PubMed  Google Scholar 

  2. Das A, Yesupatham SK, Allison D, Tanwar H, Gnanasekaran J, Kear B, Wang X, Wang S, Zachariadou C, Abbasi Y, Chung MK, Ozato K, Liu C, Foster BL, Thumbigere-Math V. Murine IRF8 mutation offers new insight into osteoclast and root resorption. J Dent Res. 2024;103(3):318–28.

    Article  CAS  PubMed  Google Scholar 

  3. Yamaguchi M, Fukasawa S. Is inflammation a friend or foe for orthodontic treatment? Inflammation in Orthodontically Induced Inflammatory Root Resorption and accelerating tooth Movement. Int J Mol Sci. 2021;22(5):2388.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Almeida-Junior LA, de Carvalho MS, Almeida LKY, Silva-Sousa AC, Sousa-Neto MD, Silva RAB, Silva LAB, Paula-Silva FWG. TNF-α-TNFR1 signaling mediates inflammation and bone resorption in apical periodontitis. J Endod. 2023;49(10):1319–28.

    Article  PubMed  Google Scholar 

  5. Dieterle MP, Husari A, Steinberg T, Wang X, Ramminger I, Tomakidi P. Role of mechanotransduction in periodontal homeostasis and disease. J Dent Res. 2021;100:1210–9.

    Article  CAS  PubMed  Google Scholar 

  6. Chen L, Yu H, Li Z, Wang Y, Jin S, Yu M, Zhu L, Ding C, Wu X, Wu T, Xun C, Zhou Y, He D, Liu Y. Force-induced caspase-1-dependent pyroptosis regulates orthodontic tooth movement. Int J Oral Sci. 2024;16(1):3.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Shi J, Gao W, Shao F, Pyroptosis. Gasdermin-mediated programmed necrotic cell death. Trends Biochem Sci. 2017;42(4):245–54.

  8. Li X, Men X, Ji L, Chen X, He S, Zhang P, Chen S. NLRP3-mediated periodontal ligament cell pyroptosis promotes root resorption. J Clin Periodontol. 2024;51(4):474–86.

    Article  CAS  PubMed  Google Scholar 

  9. Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367(6478):eaau6977.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Bi R, Lyu P, Song Y, Li P, Song D, Cui C, Fan Y. Function of dental follicle progenitor/stem cells and their potential in regenerative medicine: from mechanisms to applications. Biomolecules. 2021;11(7):997.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Huang Y, Liu Q, Liu L, Huo F, Guo S, Tian W. Lipopolysaccharide-preconditioned dental follicle stem cells derived small extracellular vesicles treating periodontitis via reactive oxygen species/mitogen-activated protein kinase signaling-mediated antioxidant effect. Int J Nanomed. 2022;17:799–819.

    Article  CAS  Google Scholar 

  12. Ma L, Rao N, Jiang H, Dai Y, Yang S, Yang H, Hu J. Small extracellular vesicles from dental follicle stem cells provide biochemical cues for periodontal tissue regeneration. Stem Cell Res Ther. 2022;13(1):92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Pu P, Wu S, Zhang K, Xu H, Guan J, Jin Z, Sun W, Zhang H, Yan B. Mechanical force induces macrophage-derived exosomal UCHL3 promoting bone marrow mesenchymal stem cell osteogenesis by targeting SMAD1. J Nanobiotechnol. 2023;21(1):88.

    Article  CAS  Google Scholar 

  14. Xu N, Cui G, Zhao S, Li Y, Liu Q, Liu X, Zhao C, Feng R, Kuang M, Han S. Therapeutic effects of mechanical stress-induced C2C12-derived exosomes on glucocorticoid-induced osteoporosis through miR-92a-3p/PTEN/AKT signaling pathway. Int J Nanomed. 2023;18:7583–603.

    Article  CAS  Google Scholar 

  15. Brodersen P, Voinnet O. Revisiting the principles of microRNA target recognition and mode of action. Nat Rev Mol Cell Biol. 2009;10:141–48.

    Article  CAS  PubMed  Google Scholar 

  16. Aure MR, Fleischer T, Bjørklund S, Ankill J, Castro-Mondragon JA, OSBREAC, Børresen-Dale AL, Tost J, Sahlberg KK, Mathelier A, Tekpli X, Kristensen VN. Crosstalk between microRNA expression and DNA methylation drives the hormone-dependent phenotype of breast cancer. Genome Med. 2021;13(1):72.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Chen ZH, Chen YB, Yue HR, Zhou XJ, Ma HY, Wang X, Cao XC, Yu Y. PAX5-miR-142 feedback loop promotes breast cancer proliferation by regulating DNMT1 and ZEB1. Mol Med. 2023;29(1):89.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Khan M, Ai M, Du K, Song J, Wang B, Lin J, Ren A, Chen C, Huang Z, Qiu W, Zhang J, Tian Y, Yuan Y. Pyroptosis relates to tumor microenvironment remodeling and prognosis: a pan-cancer perspective. Front Immunol. 2022;13:1062225.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Hua T, Yang M, Song H, Kong E, Deng M, Li Y, Li J, Liu Z, Fu H, Wang Y, Yuan H. Huc-MSCs-derived exosomes attenuate inflammatory pain by regulating microglia pyroptosis and autophagy via the miR-146a-5p/TRAF6 axis. J Nanobiotechnol. 2022;20(1):324.

    Article  CAS  Google Scholar 

  20. Genç D, Zibandeh N, Nain E, Gökalp M, Özen AO, Göker MK, Akkoç T. Dental follicle mesenchymal stem cells down-regulate Th2-mediated immune response in asthmatic patients mononuclear cells. Clin Exp Allergy. 2018;48(6):663–78.

    Article  PubMed  Google Scholar 

  21. Wang H, Li T, Jiang Y, Chen S, Zou S, Bonewald LF, Duan P. Force-loaded cementocytes regulate osteoclastogenesis via S1P/S1PR1/Rac1 axis. J Dent Res. 2023;102(12):1376–86.

    Article  CAS  PubMed  Google Scholar 

  22. Jia Y, Yu L, Ma T, Xu W, Qian H, Sun Y, Shi H. Small extracellular vesicles isolation and separation: current techniques, pending questions and clinical applications. Theranostics. 2022;12(15):6548–75.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Nakano T, Hotokezaka H, Hashimoto M, Sirisoontorn I, Arita K, Kurohama T, Darendeliler MA, Yoshida N. Effects of different types of tooth movement and force magnitudes on the amount of tooth movement and root resorption in rats. Angle Orthod. 2014;84(6):1079–85.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Qiao X, Tang J, Dou L, Yang S, Sun Y, Mao H, Yang D. Dental pulp stem cell-derived exosomes regulate anti-inflammatory and osteogenesis in periodontal ligament stem cells and promote the repair of experimental periodontitis in rats. Int J Nanomed. 2023;18:4683–703.

    Article  CAS  Google Scholar 

  25. Qianwen Wen Y 1, Wang Q, Pan. MicroRNA-155-5p promotes neuroinflammation and central sensitization via inhibiting SIRT1 in a nitroglycerin-induced chronic migraine mouse model. J Neuroinflammation. 2021;18(1):287.

  26. Nakao Y, Fukuda T, Zhang Q, Sanui T, Shinjo T, Kou X, Chen C, Liu D, Watanabe Y, Hayashi C, Yamato H, Yotsumoto K, Tanaka U, Taketomi T, Uchiumi T, Le AD, Shi S, Nishimura F. Exosomes from TNF-α-treated human gingiva-derived MSCs enhance M2 macrophage polarization and inhibit periodontal bone loss. Acta Biomater. 2021;122:306–24.

    Article  CAS  PubMed  Google Scholar 

  27. He D, Kou X, Luo Q, Yang R, Liu D, Wang X, Song Y, Cao H, Zeng M, Gan Y, Zhou Y. Enhanced M1/M2 macrophage ratio promotes orthodontic root resorption. J Dent Res. 2015;94(1):129–39.

    Article  CAS  PubMed  Google Scholar 

  28. Naveh GR, Weiner S. Initial orthodontic tooth movement of a multirooted tooth: a 3D study of a rat molar. Orthod Craniofac Res. 2015;18(3):134–42.

    Article  CAS  PubMed  Google Scholar 

  29. Jiao Y, Zhang T, Zhang C, Ji H, Tong X, Xia R, Wang W, Ma Z, Shi X. Exosomal miR-30d-5p of neutrophils induces M1 macrophage polarization and primes macrophage pyroptosis in sepsis-related acute lung injury. Crit Care. 2021;25(1):356.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Wu Z, Tan J, Lin L, Zhang W, Yuan W. microRNA-140-3p protects hippocampal neuron against pyroptosis to attenuate sevoflurane inhalation-induced post-operative cognitive dysfunction in rats via activation of HTR2A/ERK/Nrf2 axis by targeting DNMT1. Cell Death Discov. 2022;8(1):290.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Patel S, Saberi N, Pimental T, Teng PH. Present status and future directions: root resorption. Int Endod J. 2022;55(S4):892–921.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Coll RC, Schroder K, Pelegrín P. NLRP3 and pyroptosis blockers for treating inflammatory diseases. Trends Pharmacol Sci. 2022;43(8):653–68.

    Article  CAS  PubMed  Google Scholar 

  33. Hu L, Liu R, Zhang L. Advance in bone destruction participated by JAK/STAT in rheumatoid arthritis and therapeutic effect of JAK/STAT inhibitors. Int Immunopharmacol. 2022;111:109095.

    Article  CAS  PubMed  Google Scholar 

  34. Kitaura H, Fujimura Y, Yoshimatsu M, Kohara H, Morita Y, Aonuma T, Fukumoto E, Masuyama R, Yoshida N, Takano-Yamamoto T. IL-12- and IL-18-mediated, nitric oxide-induced apoptosis in TNF-α-mediated osteoclastogenesis of bone marrow cells. Calcif Tissue Int. 2011;89(1):65–73.

    Article  CAS  PubMed  Google Scholar 

  35. Zhang Q, Atsuta I, Liu S, Chen C, Shi S, Shi S, Le AD. IL-17-mediated M1/M2 macrophage alteration contributes to pathogenesis of bisphosphonate-related osteonecrosis of the jaws. Clin Cancer Res. 2013;19(12):3176–88.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Zhou F, Zhang G, Wu Y, Xiong Y. Inflammasome complexes: crucial mediators in osteoimmunology and bone diseases. Int Immunopharmacol. 2022;110:109072.

    Article  CAS  PubMed  Google Scholar 

  37. Garcia-Martin R, Wang G, Brandão BB, Zanotto TM, Shah S, Kumar Patel S, Schilling B, Kahn CR. MicroRNA sequence codes for small extracellular vesicle release and cellular retention. Nature. 2022;601(7893):446–51.

    Article  CAS  PubMed  Google Scholar 

  38. Zhou T, Pan J, Wu P, Huang R, Du W, Zhou Y, Wan M, Fan Y, Xu X, Zhou X, Zheng L, Zhou X. Dental follicle cells: roles in development and beyond. Stem Cells Int. 2019;2019:9159605.

    Article  PubMed  PubMed Central  Google Scholar 

  39. Chen X, Yang B, Tian J, Hong H, Du Y, Li K, Li X, Wang N, Yu X, Wei X. Dental follicle stem cells ameliorate lipopolysaccharide-induced inflammation by secreting TGF-β3 and TSP-1 to elicit macrophage M2 polarization. Cell Physiol Biochem. 2018;51:2290–308.

    Article  CAS  PubMed  Google Scholar 

  40. Jurdziński KT, Potempa J, Grabiec AM. Epigenetic regulation of inflammation in periodontitis: cellular mechanisms and therapeutic potential. Clin Epigenetics. 2020;12(1):186.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Jiang Y, Fu J, Du J, Luo Z, Guo L, Xu J, Liu Y. DNA methylation alterations and their potential influence on macrophage in periodontitis. Oral Dis. 2022;28(2):249–63.

    Article  PubMed  Google Scholar 

  42. Nishikawa K, Iwamoto Y, Kobayashi Y, Katsuoka F, Kawaguchi S, Tsujita T, Nakamura T, Kato S, Yamamoto M, Takayanagi H, Ishii M. DNA methyltransferase 3a regulates osteoclast differentiation by coupling to an S-adenosylmethionine-producing metabolic pathway. Nat Med. 2015;21(3):281–87.

    Article  CAS  PubMed  Google Scholar 

  43. Tanaka U, Kajioka S, Finoti LS, Palioto DB, Kinane DF, Benakanakere MR. Decitabine inhibits bone resorption in periodontitis by upregulating anti-inflammatory cytokines and suppressing osteoclastogenesis. Biomedicines. 2021;9(2):199.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Curtale G, Rubino M, Locati M. MicroRNAs as molecular switches in macrophage activation. Front Immunol. 2019;10:799.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Han XD, Chen HM, Li C. Effect of human periodontal ligament stem cell-derived extracellular vesicles on macrophage pyroptosis and periodontal inflammatory injury in periodontitis. Cells Tissues Organs. 2022;211(1):57–72.

    Article  CAS  PubMed  Google Scholar 

  46. Wang Y, Zhang X, Wang J, Zhang Y, Ye Q, Wang Y, Fei D, Wang Q. Inflammatory periodontal ligament stem cells drive m1 macrophage polarization via exosomal Mir-143-3p-mediated regulation of PI3K/AKT/NF-κB signaling. Stem Cells. 2023;41(2):184–99.

    Article  PubMed  Google Scholar 

  47. Krishnan V, Davidovitch Z. Cellular, molecular, and tissue-level reactions to orthodontic force. Am J Orthod Dentofac Orthop. 2006;129(4):e4691–32.

    Article  Google Scholar 

  48. Li Y, Zhan Q, Bao M, Yi J, Li Y. Biomechanical and biological responses of periodontium in orthodontic tooth movement: Up-date in a new decade. Int J Oral Sci. 2021;13(1):20.

    Article  PubMed  PubMed Central  Google Scholar 

  49. Lim WH, Liu B, Hunter DJ, Cheng D, Mah SJ, Helms JA. Downregulation of wnt causes root resorption. Am J Orthod Dentofac Orthop. 2014;146(3):337–45.

Download references

Acknowledgements

The authors declare that they have not use AI-generated work in this manuscript.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article. This work was supported by China Postdoctoral Science Foundation (2023M732429) and Sichuan Science and Technology Program (2024NSFSC1596).

Author information

Authors and Affiliations

  1. State Key Laboratory of Oral Diseases, National Center for Stomatology, National Clinical Research Center for Oral Diseases, Department of Orthodontics, West China Hospital of Stomatology, Sichuan University, Chengdu, Sichuan, China

    Xinyi Li, Xinyang Liu, Jianing Zhou, Ping Zhang, Song Chen & Ding Bai

Authors
  1. Xinyi Li
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Xinyang Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Jianing Zhou
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Ping Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Song Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Ding Bai
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

XYLi contributed to conception, design, data acquisition, analysis and interpretation, drafted and critically revised the manuscript; XYLiu contributed to design, data acquisition, analysis, and interpretation, drafted the manuscript; JNZ contributed to data interpretation, drafted and critically revised the manuscript; PZ contributed to data acquisition, analysis, and interpretation, and critically revised the manuscript; SC contributed to conception, design, data analysis, and interpretation, critically revised the manuscript; DB contributed to conception, design, data acquisition, analysis, and interpretation, drafted and critically revised the manuscript. All authors gave final approval and agree to be accountable for all aspects of the work.

Corresponding authors

Correspondence to Song Chen or Ding Bai.

Ethics declarations

Ethics approval and consent to participate

All animal experiments were conducted in accordance with the ARRIVE guidelines 2.0 (Animal Research: Reporting of In Vivo Experiments) and approved by the Ethics Committee for the Use of Animals of West China hospital of stomatology, Sichuan University. (Approval No. WCHSIRB-D-2024-045 “Research on the Inhibition of Orthodontic Inflammatory Root Resorption by Dental Follicle Stem Cell-Derived Exosomes circPVT1 through Regulating Pyroptosis of Periodontal Ligament Cells” approved on Feb 28, 2024). All Human experimental procedures were conducted in accordance with the Declaration of Helsinki and the Belmont report and approved by the Human Research Ethics Committee of West China hospital of stomatology, Sichuan University. (Approval No. WCHSIRB-CT-2024-055 “Research on the Inhibition of Orthodontic Inflammatory Root Resorption by Dental Follicle Stem Cell-Derived Exosomes circPVT1 through Regulating Pyroptosis of Periodontal Ligament Cells” approved on Feb 28, 2024). All samples were obtained from donors with their written informed consent.

Consent for publication

Not applicable.

Competing interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Li, X., Liu, X., Zhou, J. et al. Human dental follicle stem cell-derived exosomes reduce root resorption by inhibiting periodontal ligament cell pyroptosis. Stem Cell Res Ther 16, 79 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13287-025-04216-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13287-025-04216-6

Keywords

Stem Cell Research & Therapy

ISSN: 1757-6512